Labshake search
Citations for Charles River Labs :
1 - 50 of 186 citations for Cow Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: WT Neuronal and astrocyte cultures were obtained from CD1 mice from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal cell cultures were dissociated from E16 pregnant C57/6N females purchased from Charles River. See key resources table for more information.
-
bioRxiv - Neuroscience 2020Quote: Primary cortical neuronal cultures were prepared from embryonic day 15–16 CD1 fetal mice (Charles River) (14 ...
-
bioRxiv - Neuroscience 2020Quote: Neuronal cultures were prepared from embryonic day 17 Sprague-Dawley rats (Charles River, Wilmington, MA, USA). Embryos were obtained from two to three pregnant dams ...
-
bioRxiv - Neuroscience 2019Quote: Low density rat cortical neuronal cultures were prepared from embryonic day (E) 18 rat embryos (Charles River) as previously described(Verpelli et al. ...
-
bioRxiv - Cell Biology 2024Quote: All neuronal experiments utilized wild-type rats of the Sprague-Dawley strain (Charles River code 400, RRID: RGD_734476). These experiments were conducted in accordance with approved protocols by the Weill Cornell Medicine IACUC ...
-
bioRxiv - Microbiology 2022Quote: ... 7-week-old male CD1 (Charles River) mice were challenged intravenously with 1 × 109 CFU of WT COH1 or the isogenic ΔmprF mutant ...
-
bioRxiv - Biochemistry 2023Quote: Primary neuronal cultures were obtained from cerebral cortex of mouse embryos at gestation day 14–16 (Charles River Laboratories). The neurons were dissociated using Papain Dissociation System (Worthington Biochemical Corporation ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells with constitutive expression of CaV subunits β3 and α2δ1 and inducible expression of α1D (Charles River Laboratories CT6232) were cultured in DMEM/F12 medium containing selection antibiotics and 0.6 µM isradipine (Sigma I6658) ...
-
bioRxiv - Neuroscience 2020Quote: Wistar female rats (7-10 weeks old) and C75BL/6J mice (7-12 weeks old) were purchased from Charles River Laboratories ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: 7 male C57BL/6 mice (Charles River Laboratory) were trained in this project ...
-
bioRxiv - Neuroscience 2023Quote: C57BL/6J male mice (7 weeks; Charles River) were habituated to the holding facility for one week prior to use ...
-
bioRxiv - Genomics 2023Quote: ... 7-weeks old and purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2023Quote: Postnatal glia-free rat cortical neuronal cultures were prepared from male P1 rat pups (Sprague Dawley, Charles River Laboratories, SD-001). Cerebral cortices were micro-dissected and enzymatically dissociated with papain (~7.5 units/mL ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 mice 5-7 weeks old (Charles River) were used ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 mice 5-7 weeks old (Charles River) were used ...
-
bioRxiv - Microbiology 2021Quote: ... 7-9 week old male Syrian hamsters (Charles River) were infected intranasally with a total dose of approximately 5000 PFU of SARS-CoV-2 suspended in 50μL sterile DMEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Athymic nude mice (Charles River Laboratories, 6-7 weeks) were used for animal study.
-
bioRxiv - Neuroscience 2022Quote: ... 7 female C57BL/6 mice (Charles River Laboratories, Inc.), 8-16 weeks at the start of the study ...
-
bioRxiv - Immunology 2021Quote: Female C57BL/6J mice (7 weeks old; Charles River Laboratories Japan ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... in male 7-week-old C57BL/6J (Charles River) mice ...
-
bioRxiv - Bioengineering 2020Quote: ... 6-7 week old female BALB/c mice (Charles River) were acclimated for a week prior to experiments ...
-
bioRxiv - Genetics 2021Quote: ... Postnatal day 7-10 old Sprague-Dawley rats (Charles River) bred in-house were sacrificed via cervical dislocation and cortex was quickly dissected ...
-
bioRxiv - Bioengineering 2021Quote: ... C57BL/6 mice (7-8 weeks old; Charles River Laboratories) were subsequently subcutaneously injected with 100 μL of 3 x 106 B16F10 cells/mL in PBS above the right hind leg ...
-
bioRxiv - Microbiology 2021Quote: Female OF1 mice (6-7 weeks, Charles River Laboratories, NL) were used ...
-
bioRxiv - Immunology 2022Quote: ... 7–9-week-old BALB/c mice from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 C57BL/6J male mice were obtained from Charles River. 2 GAD-67 and 9 VGAT-cre male mice were bred in house Animalerie Centrale ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... 7-8-week old female NIH-III nude mice (Charles River) weighing approximately 18-22 g were inoculated subcutaneously into the right lower flank in 0.1 mL of serum-free MEM medium mixed with basement membrane Matrigel (in a 1:1 ratio ...
-
bioRxiv - Neuroscience 2019Quote: Male Long-Evans rats (n = 7; Charles River Labs, Wilmington, MA) were housed individually in plexiglass cages and kept on a 12-h light/dark cycle ...
-
bioRxiv - Immunology 2021Quote: ... Mice at 7 weeks of age were obtained from Charles River Laboratories (Wilmington ...
-
bioRxiv - Cancer Biology 2020Quote: ... To each male SCID/Beige mouse (7-week old; Charles River), 100 μL of 1 × 107 cells/mL in DPBS was intracardially injected into the left cardiac ventricle ...
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Bioengineering 2021Quote: ... Mice (7-week-old female C57BL/6J, Charles River Japan Inc.) were anesthetized by inhalation of 2% isoflurane ...
-
bioRxiv - Bioengineering 2021Quote: ... Rats (7-week-old male Sprague-Dawley, Charles River Japan Inc.) were anesthetized by inhalation of 2.5% isoflurane ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 weeks old female NOD/SCID mice obtained from Charles River Laboratories were injected in each flank with one million cells diluted 1:1 in matrigel:PBS ...
-
bioRxiv - Microbiology 2019Quote: Female 7-week-old OF1 mice were purchased from Charles River France and allowed to acclimate for 1 week before infection ...
-
bioRxiv - Pathology 2021Quote: Male athymic rnu/rnu rats (age 6-7 weeks, Charles River) weighing 160-200 g were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... 7 week-old female nude mice were purchased from Charles River and housed in a pathogen-free room with a 12 h light/dark cycle ...
-
bioRxiv - Immunology 2023Quote: 7-9 week old male Syrian Hamsters purchased from Charles River Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7-10 weeks old CD1 mice were sourced from Charles River. Pregnant mice were dissected at ...
-
bioRxiv - Molecular Biology 2020Quote: Adult female Long Evans rats (7 week) were purchased from Charles River, Canada (St ...
-
bioRxiv - Cancer Biology 2021Quote: 7-9 weeks old male C57BL/6 (Charles River, Saint Constant, QC) and TLR4-/- (from Dr ...
-
bioRxiv - Physiology 2021Quote: Male C57BL/6J mice (7 weeks old) were purchased from Charles River Laboratories (Kanagawa ...
-
bioRxiv - Neuroscience 2021Quote: C57BL/6J mice (7–9 weeks old) were purchased from Charles River Laboratories Japan ...
-
bioRxiv - Neuroscience 2020Quote: ... 7-week old male CD-1 mice were supplied by Charles River Laboratories and housed in identical enriched home cages in groups of 3-4 upon arrival ...
-
bioRxiv - Microbiology 2021Quote: ... groups of female C57BL/6 mice aged 6–7 weeks (Charles River) were pretreated with a single dose of streptomycin (1 g/kg in 200 μl water ...
-
bioRxiv - Neuroscience 2022Quote: ... CD-1 (5-7 weeks old, Charles River Laboratories, Kingston, NY, USA), and CF-1 (5-7 weeks old ...
-
bioRxiv - Neuroscience 2020Quote: Male CD rats (7-8 weeks old) were purchased from Charles River and male C57BL/6J mice (8-12 weeks old ...