Labshake search
Citations for Charles River Labs :
1 - 45 of 45 citations for Charged Multivesicular Body Protein 2b CHMP2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Balb/c (H-2b) (Charles River laboratories, USA) and male Sdc-1 knockout mice on a C57Bl/6 background (22 ...
-
bioRxiv - Immunology 2023Quote: Wild-type six- to eight-week-old female C57BL/6 J mice (H-2b) and C57BL/6 N albino mice named B6N-Tyrc-Brd/BrdCrCrl (H-2b) were purchased from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Bioengineering 2023Quote: ... body weight 250-400 g (Charles River Laboratories ...
-
bioRxiv - Immunology 2019Quote: 5-6 week old female C57BL/6 (H-2b) mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2020Quote: Six- to eight-week-old female C57BL/6 (H-2b) mice were purchased from Charles River Laboratory (Charles River Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... we collected fecal samples and body swabs for zoonoses testing by Charles River. The only agent of concern found was fur mites ...
-
bioRxiv - Microbiology 2021Quote: Adult female CD-1 mice (20–30 g body weight; Charles River Laboratories) were infected with 5 × 104 wild-type T ...
-
bioRxiv - Immunology 2020Quote: Eight to 12 week-old female C57BL/6 (B6, H-2b, CD45.2) and BALB/c (H-2d, CD45.2) recipient mice were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: Female Sprague-Dawley rats (initial body weight: 240–250g; Charles River, Margate, Kent, UK) were maintained on ad libitum standard rat chow (Teklan 2014 diet ...
-
bioRxiv - Bioengineering 2020Quote: Female C57BL/6N mice (12 weeks; body weight 20 – 25 g; Charles River Laboratories) were housed in the Charité animal facility (FEM ...
-
bioRxiv - Neuroscience 2021Quote: Food restricted (85% of body weight) Long Evans rats (n = 9, Charles River Laboratories) were trained on a previously described spatial delayed alternation (SDA ...
-
bioRxiv - Microbiology 2021Quote: ... Golden Syrian hamsters of 90-101 g body weight were obtained from Charles River Laboratories and singly housed on paper bedding with access to food and water ad libitum ...
-
bioRxiv - Neuroscience 2023Quote: Food restricted (85% of body weight) Long Evans rats (n = 13, Charles River Laboratories) were trained to perform a spatial set shifting task ...
-
bioRxiv - Neuroscience 2023Quote: Adult male NMRI mice (25–30 g body weight at arrival; Charles River; Sulzfeld, Germany) were used ...
-
bioRxiv - Molecular Biology 2021Quote: Male C57BL/6 mice (n=6) (body weight, 18–22 g; Charles River Laboratories, Sulzfeld, Germany) were subjected to 60 min transient middle cerebral artery occlusion (MCAo) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Male C57BL/6 mice (12-weeks-old, body weight 25– 30 g; Charles River, Sulzfeld, Germany) were housed under standardized conditions with a day-night cycle of 12 h/12 h at 22 ± 1°C and 50 ± 10% environmental humidity ...
-
bioRxiv - Cell Biology 2019Quote: ... body weight 25±5 g C57BL/6 mice were used for this study and obtained from Charles River. Left ventricular (LV ...
-
bioRxiv - Neuroscience 2019Quote: Experiments were performed on adult male Sprague-Dawley rats (Charles River, body weight 300-400g. Animals (n = 5) were anesthetized with 1.5–2.0 ml/min of isoflurane in 100% oxygen and fixed in a stereotactic surgery frame ...
-
bioRxiv - Evolutionary Biology 2020Quote: 30-day-old C57BL/6 mice (body weight 14.59±0.72g) and 10-day-old Sprague Dawley rats (body weight 20±0.49g) were purchased from Charles River Laboratories and Janvier Labs (Europe) ...
-
bioRxiv - Neuroscience 2023Quote: Adult male and female Sprague Dawley (SD) rats weighing 100-125g body weight (Charles River Laboratories, Wilmington, MA) were used ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Neuroscience 2020Quote: ... 150-400 g body weight) and for hypophysectomy (Figure 4A and Figure 4— figure supplement 1B-E) (Charles River Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Lean male C57Bl/6 mice (8-10 weeks of age, body weight 25-30 g, obtained from Charles River) were maintained at 21-23°C and 12-hour light-dark cycles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Lean male C57BL/6 mice (8-16 weeks of age, body weight 25-30 g, purchased from Charles River) were maintained at 21-23°C and light-dark cycles (12:12 hour schedule ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Lean male C57Bl/6 mice (8-10 weeks of age, body weight 25-30 g, obtained from Charles River) were maintained at 21-23°C and 12-hour light-dark cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Fifteen C57Bl/6J mice (age at reception: 1010 weeks, body weight: 20-25 g) were purchased from Charles River Laboratory (BerthevinL’Arbresle ...
-
bioRxiv - Bioengineering 2022Quote: ... National Institutes of Health (NIH) Swiss mice (6–8 weeks, ∼25 g body weight, female) were purchased from Charles River Laboratory (Wilmington ...
-
bioRxiv - Physiology 2023Quote: C57BL/6 8-12 weeks old male and female mice (20-25 g, body weight) mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2023Quote: Forty-four 56 day-old rats (body weight: 150-250 g; males: n=22, females: n=22) were purchased from Charles River for the study ...
-
bioRxiv - Immunology 2024Quote: ... Female BALB/c mice of 11-16 weeks with body weight between 19 and 24 g were used for the experiments (Charles River, Sulzfeld, Germany). The local animal facility environment had a temperature of 22°C and a humidity of 45-60% followed a 12-hour light/dark cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Pathology 2020Quote: Samples collected at preinfection and weekly post-infection until necropsy were tested for detection of binding IgG antibodies against SARS-CoV-2 nucleoprotein (NP) by MFIA COVID-Plex from Charles River Laboratories ...