Labshake search
Citations for Charles River Labs :
1 - 10 of 10 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... CRISPR/Cas9 targeted mice were generated using C57BL/6N mice (Charles River) by the transgenic core of the National Heart ...
-
bioRxiv - Genomics 2023Quote: ... CRISPR/Cas9 targeted mice were generated using C57BL/6N mice (Charles River) by the transgenic core of the National Heart ...
-
bioRxiv - Genomics 2023Quote: ... CRISPR/Cas9 targeted mice were generated using C57BL/6N mice (Charles River) by the transgenic core of the National Heart ...
-
bioRxiv - Immunology 2024Quote: ... Immunodeficient NOD CRISPR Prdkc Il2r Gamma (NCG) mice were purchased from Charles River (Stock # 572). The Pvrig KO mice were derived from sperm obtained through the NIH Knockout Mouse Project (KOMP ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Cancer Biology 2019Quote: ... The specific pathogen free status of these cells was confirmed by PCR screening for mouse/rat comprehensive panel (Charles River). MC38 ...
-
bioRxiv - Genetics 2024Quote: CRISPR-Cas9 targeted mice were generated using B6D2F1/J (deletion of enhancer 1, E1) or C57BL/6N (E2) (Charles River) or by the transgenic core of the National Heart ...
-
bioRxiv - Neuroscience 2020Quote: ... For high content screening (HCS) microscopy experiments, male C57Bl/6N mice (>24 g, aged 8-10 weeks) were obtained from Charles River. Mice were housed in a temperature- and humidity-controlled animal care facility at the University Hospital of Cologne on a 12 h light/dark cycle and provided with food and water ad libitum.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... a CRISPR targeting the Fmr1 exon 8 sequence 5’-GGTCTAGCTATTGGTACTCATGG-3’ (PAM in bold) was injected into Crl:LE embryos (Charles River Laboratories). Two mutant strains were generated (LE-Fmr1em2Mcwi and LE-Fmr1em4Mcwi (RGDIDs ...
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...