Labshake search
Citations for Charles River Labs :
351 - 400 of 549 citations for Mouse Anti Hepatitis C Virus NS5a Antibody 1827 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Female 6-week-old Fox Chase SCID-beige and female BALB/c mice (Charles River Laboratories) were inoculated subcutaneously in both hind footpads with 0.03 ml of a culture suspension containing M ...
-
bioRxiv - Microbiology 2021Quote: Groups of three mice (female BALB/c mice of 6-8-week-old, Charles River, UK) were assigned to a cage and the small group size was based on the subsequent genetic analysis ...
-
bioRxiv - Cancer Biology 2022Quote: Eight-to ten-week-old C57BL/6J and BALB/c mice were purchased from Charles River Laboratory ...
-
bioRxiv - Immunology 2019Quote: Adult female BALB/c (H-2d) Specific Pathogen Free (SPF) mice were purchased from Charles River Laboratories UK and maintained in autoclaved Individually Ventilated Cages (IVC ...
-
bioRxiv - Microbiology 2020Quote: ... mexicana promastigotes were injected into the right footpad of female BALB/c mice (Charles River Laboratories). Lesion size was monitored weekly ...
-
bioRxiv - Cell Biology 2020Quote: Male and female C57BL/6 mice and BALB/c mice were purchased from Charles River (Germany) at the age of 10-14 weeks ...
-
bioRxiv - Physiology 2021Quote: ... Male and female BALB/c mice and female CD-1 mice were purchased from Charles River, allowed to adapt for 1–2 weeks following shipment and were studied at 10-12 weeks of age ...
-
bioRxiv - Immunology 2021Quote: ... B6-Ly5.1 (B6.SJL-Ptprca Pepcb/BoyCrl) and BALB/c mice were purchased from Charles River or Jackson Laboratory ...
-
bioRxiv - Immunology 2021Quote: Six to eight week old male and female BALB/c mice were purchased from Charles River Laboratories (Quebec ...
-
bioRxiv - Bioengineering 2022Quote: ... subcutaneous tumours were established in male BALB/c nude mice (Charles River, age 8-10 weeks). 1.5×106 PC3 prostate adenocarcinoma cells suspended in a mixture of 50 μL PBS and 50 μL matrigel (354248 ...
-
bioRxiv - Neuroscience 2024Quote: ... Administration of CORT increased the propensity to sign-track in (c) male rats from Charles River compared to their VEH counterparts (post hoc ...
-
bioRxiv - Immunology 2023Quote: Female 6-8 week old Balb/c and RAG2-KO mice were ordered from Charles River Laboratories Inc. ...
-
bioRxiv - Bioengineering 2023Quote: C57BL/6 mice and Balb/c mice (6–8 weeks old) were purchased from Charles River Laboratory ...
-
bioRxiv - Cancer Biology 2024Quote: ... Female BALB/c mice aged 6-8 wks (20-30 g) were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Cancer Biology 2024Quote: 6-8 week old BALB/c nude mice (CAnN.Cg-Foxn1nu/Crl) were purchased from Charles River Laboratories ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cancer Biology 2021Quote: Tumour growth on chicken embryo chorioallantoic membranes (CAMs)3 or Balb/c nude mice (Charles River, #490) was performed as described previously29 ...
-
bioRxiv - Bioengineering 2020Quote: ... Eight-week-old female C57BL/6 mice and BALB/c nude mice were purchased from Charles River for imaging studies and housed at the Research Animal Facility of Stanford University.
-
bioRxiv - Microbiology 2019Quote: Age (6-8 weeks) and sex matched wild-type BALB/c mice were purchased from Charles River Laboratories UK ...
-
bioRxiv - Immunology 2021Quote: ... 6 week-old female specific-pathogen-free BALB/c-Elite and C57BL/6J-Elite mice (Charles River) were injected subcutaneously with 10^6 CFU Ft-ΔclpB (BALB/c and C57BL/6J) ...
-
bioRxiv - Neuroscience 2021Quote: ... Adult BALB/c male mice were purchased from Charles River (8-10 weeks old; Wilmington, MA, USA) and housed under a 12:12 light:dark cycle with ad libitum access to standard mouse chow and water.
-
bioRxiv - Genomics 2020Quote: C57BL/6J@Ico (C57BL/6) and BALB/cByJ@Ico (BALB/c) mice were purchased from Charles River Laboratories (Calco ...
-
bioRxiv - Immunology 2020Quote: Female BALB/c mice and Swiss Webster mice aged 6-8 weeks were purchased from Charles River Laboratories (Senneville ...
-
bioRxiv - Immunology 2021Quote: ... Six-to-eight-week-old specific pathogen-free female Balb/c mice were purchased from Charles River and kept at the institutional animal facility under specified pathogen-free conditions ...
-
bioRxiv - Neuroscience 2022Quote: Adult male and female Balb/C mice (F0; approximately 3 months of age) purchased from Charles River were used to generate offspring for these studies ...
-
bioRxiv - Immunology 2022Quote: ... and combinations of both components in naïve mice were conducted as follows: BALB/c mice (Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... Male BALB/c mice (8-10 weeks of age, n = 5-7 animals/group, Charles River Laboratories) received either vehicle (PBS ...
-
bioRxiv - Immunology 2024Quote: BALB/cAnNCrl wild-type and BALB/c CAnN.Cg-Foxn1nu/Crl athymic mice were purchased from Charles River Laboratories or bred for in vivo experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Ten female BALB/c elite mice aged 6-to-8-weeks old (Charles River Laboratories, ON, Canada) were intranasally inoculated with 50 μL of the C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Male BALB/c mice (8-10 weeks of age, n = 4 -18 animals/group, Charles River Laboratories) received either vehicle (PBS/DMSO) ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Bioengineering 2024Quote: ... Mouse embryos were collected from pregnant C57BL/6 mice (Charles River Laboratories INC) based on previous reports52,53 ...
-
bioRxiv - Immunology 2019Quote: All experiments were conducted with female 8 to 12-weeks-old BALB/c mice (Charles River, Sulzfeld, Germany). Mice were maintained in individually ventilated (IVC ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... Aged-matched 6-8 week-old female BALB/c or C57BL/6 mice were purchased from Charles River. All mice were housed in individually ventilated cages ...
-
bioRxiv - Microbiology 2021Quote: ... Female BALB/c mice (8-12 weeks) were used in these experiments and were purchased from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: Five to six-week-old female C57BL/6 mice and Balb/c mice were purchased from Charles River Laboratories and The Jackson Laboratory ...
-
bioRxiv - Bioengineering 2019Quote: ... Subcutaneous tumours were established in male BALB/c nude mice (Charles River, 7-10 weeks old, 17-22g) by inoculation of cells from one of three different cancer cell lines in both flanks (1.5×106 LNCaP prostate adenocarcinoma cells ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour growth studies used 6-week-old female BALB/c nude mice (13-16g) (Charles River, Kent, UK). Experiments were carried out in accordance with local guidelines and with Home Office approval under project licence 70/8799 ...
-
bioRxiv - Immunology 2020Quote: BALB/c (H2-Kd) and C57BL/6 (B6, H2-Kb) mice were purchased from Charles River (Frederick, MD). Animals were housed in specific pathogen-free conditions and experiments conducted in accordance with National Institutes of Health guidelines ...
-
bioRxiv - Immunology 2021Quote: Female C57BL/6 or BALB/C (as specified) mice aged 5-8 weeks were obtained from Charles River UK Ltd ...