Labshake search
Citations for Promega :
1 - 38 of 38 citations for Vitamins Trace Elements and Antioxidant Supplements since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... cells were co-transfected with firefly luciferase plasmid [pGL4.37 E364A for ARE(antioxidant response element):luciferase assays (Promega); pSGG containing the human Nrf2 3ʹ–UTR sequence (from Prof ...
-
bioRxiv - Immunology 2023Quote: ... and the interferon stimulation response element (ISRE) (Promega), were also transfected into the cells ...
-
bioRxiv - Physiology 2023Quote: ... the oligo with NF-κB consensus binding element (Promega) was end-labeled by T4 polynucleotide kinase (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Full-length L1 elements were then cloned into pGEMT Easy Vector (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the total RNA was incubated with DNase I to remove the trace amount of DNA (Promega Company, Madison. Wisconsin. USA) for two hours ...
-
bioRxiv - Biochemistry 2021Quote: The heat shock element (HSE) firefly luciferase reporter was purchased from Promega (Madison, WI) and has two copies of the HSE promoter driving the luc2P gene ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Genomics 2023Quote: ... This TP53 response element is controlling the GADD45A gene (7) and is commercially available (pGL4.38, Promega). The benchmark response element was also linked to the three selected spacer sequences and the two core promoters ...
-
bioRxiv - Cell Biology 2023Quote: ... Promoter elements used in luciferase reporter expression analyses were cloned into the pGL3-basic vector (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... synthetic gene fragments containing response elements were inserted into a pGL4.23[luc2/minP] vector obtained from Promega using KpnI and HindIII (for SRE ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid pGL4.32 containing a firefly luciferase cassette under NF-κB response elements was obtained from Promega (Cat# E8491). For overexpression of ubiquitin ...
-
bioRxiv - Genetics 2021Quote: ... this vector was re-cut at the NheI site and the transcriptional insulator element from pGL4.23 (Promega, E8411) was inserted using Gibson Assembly (78) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Conserved Elements (CE) were PCR-amplified from GB genomic DNA using GoTaq® G2 DNA Polymerase (Promega, #M7845) (primer sequences listed in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: The Foxo1/3/4 responsive luciferase reporter plasmid was constructed by inserting six FoxO REs (FoxO-responsive elements) into the pGL4.23 (Promega). The following sequence was used for the FoxO RE ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting Cckbr1 expression construct was transiently transfected into Hela cells together with a luciferase reporter vector containing cis-acting elements responsive to cAMP (pGL4.29; Promega), Ca2+-dependent nuclear factor of activated T-cells (NFAT ...
-
bioRxiv - Physiology 2023Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Genetics 2024Quote: ... Existing plasmids constructs of variant-centered test elements for the five variants of interest (see Dataset S1 for genomic regions) cloned in the pGL4.23 vector (Promega) were used as the initial template in PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... beads were resuspended in 100 μl TMG(50) plus supplements and 0.4 U/μl RNasin (Promega) and frozen in liquid nitrogen.
-
bioRxiv - Immunology 2019Quote: The plasmid pNL3.2.NF-κB-RE[NlucP/NF-κB-RE/Hygro] (#N1111) encoding the NanoLuc luciferase under the control of the NF-κB response element was obtained from Promega AG ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Jurkat T cells overexpressing hPD-1 and carrying a luciferase reporter gene under the control of Nuclear Factor of Activated T-cells Response Element (NFAT-RE) (hPD-1 Effector Cells, hPD-1 ECs, Promega) were cultured in RPMI-1640 medium (Biowest ...
-
bioRxiv - Molecular Biology 2021Quote: ... The NF-κB reporter plasmid containing five copies of an NF-κB response element fused to the firefly luciferase gene and TK-renilla control plasmid were obtained from Promega. The IFIT1 (ISG56 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The BRE response element was inserted upstream of the minimal promotor region of plasmid pGL4.26 luc2/minP/Hygro (Promega E8441) that also encodes the luciferase reporter gene luc2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and the -1680 bp to +8 bp and -1525/-1495 element mutant were constructed in the pGL3-Basic luciferase reporter vector (Promega) using standard molecular biology techniques ...
-
bioRxiv - Microbiology 2022Quote: ... carrying 6 copies of the HNF4 transcriptional response element upstream of a secreted Gaussia luciferase (Gluc) reporter gene was transfected (FuGENE, Promega) into confluent Caco-2 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... a 625bp fragment around the MRC2 transcriptional start site in a Firefly luciferase vector with a minimal promoter element (Promega) was used as previously described18 ...
-
bioRxiv - Genetics 2020Quote: The CRE-luciferase reporter was generated by putting the cAMP regulatory elements (CRE) in front of firefly luciferase in pGL4 basic vector (Promega, E134A). hRenilla luciferase (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... from Huh7 genomic DNA and inserted the promoter element upstream of the firefly luciferase open reading frame in the pGL2-Basic vector (Promega Corp.). In all cases ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... antioxidant response element (ARE; TGACTCTGC) or mutated ARE (ATCGAGATA) was conjugated to the translation start site in the pGL3-basic vector (Promega, Madison, Wisconsin). HEK-293T cells were plated in 24-well plates 24 h before transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Modified Jurkat ADCC effector cells expressing hFcγRIIIa and firefly luciferase downstream of an NFAT response element were obtained from Promega (G7102, Madison, WI) and cultured according to the kit protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... pGL4-AP1 (containing six copies of an AP1-response element fussed to luciferase gene) and PGLA4.32-NF-κB (five copies of a NF-κB response element) vectors were from Promega (Madison, WI, USA).
-
bioRxiv - Biochemistry 2024Quote: The firefly luciferase reporter plasmids bearing eight repeats of the wild-type and mutated JH response element from the Aedes aegypti early trypsin gene followed by its minimal promoter in the pGL4.17 vector (Promega, Madison, WI, USA) were described earlier.9 In this study ...
-
bioRxiv - Cancer Biology 2020Quote: ... GTIIC also known as MCAT and Hippo response element) (53) and the renilla luciferase reporter plasmid (pRL-TK Renilla, (Promega, Madison, WI, USA) in a well from a 6-well plate (biological triplicates) ...
-
bioRxiv - Biochemistry 2022Quote: ... pGL4.30-NFAT-RE firefly luciferase (NFAT-luc) driven by the NFAT response element and Renilla luciferase (TK-Rluc) vectors were from Promega (Seo et al., 2014b). Alanine substitution mutants ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Systems Biology 2019Quote: ... was added to 800 µl of Opti-MEM with GlutaMAX supplement along with 16 µl FuGENE® HD Transfection Reagent (Promega Corporation), incubated for 15-30 minutes in a biosafety cabinet ...