Labshake search
Citations for Promega :
1 - 50 of 1158 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 293T cells were co-transfected with pEGFP-N1 and plasmids expressing SARS-CoV-2 Spike (FL) or SARS-CoV-2 Spike-Δ19 for 24 h using FugeneHD (Promega). The cells were treated with DMSO or 10 µM 6-TG at 4 h post- transfection ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
Multimodal tubulin binding by the yeast kinesin-8, Kip3, underlies its motility and depolymerizationbioRxiv - Biophysics 2021Quote: ... An N-terminal HALO tag (Promega) for fluorescent labelling was fused to the coding sequence through a GGSGGSLQ linker ...
-
bioRxiv - Microbiology 2022Quote: ... and a spike-expressing plasmid (pCAGGS-SARS-CoV-2-spike) were co-transfected into HEK293T cells using Fugene HD transfection reagentia (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: The SARS-CoV-2 spike pseudotyped virus activity was determined by bright-glo luciferase assay (Promega). The plate reader detected the luminescence two days post virus infection or without virus infection ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We also included N-terminal and C-terminal HiBiT tags (Promega, Madison, WI) for quantification using luminescence ...
-
bioRxiv - Microbiology 2020Quote: ... 18h (SARS-CoV-2) or 24h (SARS-CoV) later by adding 1μM of Coelenterazine-H (Promega) at 1:400 dilution in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2022Quote: ... NTD and Spike - was achieved for 24 h using ProFection Mammalian Transfection System (Promega) or adenovirus infection ...
-
bioRxiv - Biochemistry 2021Quote: ... which contains a pRSET backbone with an N-terminal 6xHis tag and the insertion of a biotin tag from the PinPoint™ Xa-1 Vector (Promega, USA) in between the His tag and the first fluorescent protein ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Biophysics 2023Quote: ... insertion of the FUS N-terminal domain) were synthesized and sequenced by the Genewiz Company from a pFN22A vector (Promega) containing the insert HaloTag-p53 WT ...
-
bioRxiv - Biochemistry 2023Quote: ... with the C-terminal HiBiT-Tag (Promega), using the In-Fusion cloning kit ...
-
bioRxiv - Biochemistry 2019Quote: ... The N-terminal 312 aa Halo tag sequence was PCR amplified from His6HaloTag® T7 Vector pH6HTN (Promega) as a 5’ SpeI ...
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Biochemistry 2019Quote: ... Dimeric constructs are based on VY208 and were created by artificially dimerization through an N-terminal GST-tag (Reck-Peterson et al, 2006) and tagged with a HaloTag (Promega) at the C-terminus as well as a GFP at the very N-terminus ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2023Quote: ... N-terminal small bit (SmBiT) tagged construct (Promega), with the native HSV-TK promoter swapped out for a CMV promoter ...
-
bioRxiv - Biochemistry 2023Quote: N-terminal large (LgBit) and C-terminal small (SmBit) fragments derived from NanoLuc (Promega) were fused to the C-terminus of B56δ and inserted downstream of its N-arm at residue 103 ...
-
bioRxiv - Biophysics 2023Quote: ... Halo-EGFR constructs used for FRET-FLIM experiments were created using the HA-EGFR plasmid and the Gibson assembly approach to replace the N-terminal HA tag with the HaloTag® plasmid (Promega, #G7711). The final resulting construct contained the HaloTag and a GSGS linker region after the EGFR signal sequence ...
-
bioRxiv - Microbiology 2022Quote: ... either with SARS-CoV-2 S and Jun or with ACE2 and Fos plus the pRL Renilla Luciferase (Promega) to normalize the signal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2021Quote: The effect of neutralization capacity of Multivalent DARPin was evaluated by exposing serial dilutions of the DARPin candidates to increasing titers of SARS-CoV-2 and determining cell protection by CellTiter-Glo assay (Promega, Madison, USA). Serial dilution of DARPin candidates were prepared in 96 well plates in 100 µl cell culture medium (2%-FBS-MEM + HSA ...
-
bioRxiv - Microbiology 2021Quote: N-terminal HaloTag KIF4 expressing plasmid (pFN21ASDB3041) was purchased from Promega. The N-terminal Myc-tagged KIF4 (both wild type and ATPase-null motor inactive mutant ...
-
bioRxiv - Microbiology 2022Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used in this study were as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MSN(T558A) genes with either N-terminal or C-terminal SmBit and LgBiT fusions were produced using Flexi®-based cloning (Promega). Best luminescence signals were obtained with CD44 containing a C-terminal smBiT fusion (C-terminal smBiT ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 500 ng of either HDM-SARS-Spike-delta21 or HDM_Spike_RBD_B7-1 plasmids and 1.5 ng of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with NOCT N-terminal mutant constructs using Fugene HD (Promega) in a ratio of 3 µL transfection reagent per 1 µg DNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: N-terminal NanoLuc/Kinase fusions were encoded in pFN31K or pFC32K expression vectors (Promega), including flexible Gly-Ser-Ser-Gly linkers between Nluc and each full-length kinase ...
-
bioRxiv - Biochemistry 2022Quote: ... N-or C-terminal NanoLuc/Kinase fusions were encoded in pFN31K expression vectors (Promega), including flexible Gly-Ser-Ser-Gly linkers between Nluc and each full-length kinase ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...