Labshake search
Citations for Promega :
1 - 50 of 1048 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 293T cells were co-transfected with pEGFP-N1 and plasmids expressing SARS-CoV-2 Spike (FL) or SARS-CoV-2 Spike-Δ19 for 24 h using FugeneHD (Promega). The cells were treated with DMSO or 10 µM 6-TG at 4 h post- transfection ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Microbiology 2022Quote: ... and a spike-expressing plasmid (pCAGGS-SARS-CoV-2-spike) were co-transfected into HEK293T cells using Fugene HD transfection reagentia (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: The SARS-CoV-2 spike pseudotyped virus activity was determined by bright-glo luciferase assay (Promega). The plate reader detected the luminescence two days post virus infection or without virus infection ...
-
bioRxiv - Microbiology 2020Quote: ... 18h (SARS-CoV-2) or 24h (SARS-CoV) later by adding 1μM of Coelenterazine-H (Promega) at 1:400 dilution in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Microbiology 2022Quote: ... either with SARS-CoV-2 S and Jun or with ACE2 and Fos plus the pRL Renilla Luciferase (Promega) to normalize the signal ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2021Quote: The effect of neutralization capacity of Multivalent DARPin was evaluated by exposing serial dilutions of the DARPin candidates to increasing titers of SARS-CoV-2 and determining cell protection by CellTiter-Glo assay (Promega, Madison, USA). Serial dilution of DARPin candidates were prepared in 96 well plates in 100 µl cell culture medium (2%-FBS-MEM + HSA ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Microbiology 2022Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used in this study were as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 500 ng of either HDM-SARS-Spike-delta21 or HDM_Spike_RBD_B7-1 plasmids and 1.5 ng of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...
-
bioRxiv - Biochemistry 2021Quote: ... which contains a pRSET backbone with an N-terminal 6xHis tag and the insertion of a biotin tag from the PinPoint™ Xa-1 Vector (Promega, USA) in between the His tag and the first fluorescent protein ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... In vitro transcribed RNA derived from plasmid “pCI/SARS-CoV envelope” was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega), then purified by phenol/chloroform extractions and two successive precipitations with isopropanol and ethanol ...
-
bioRxiv - Immunology 2024Quote: ... FC tags on the S and RBD proteins were removed through treatment with Factor Xa Proteinase (Promega).
-
bioRxiv - Biochemistry 2024Quote: ... The binding of the Nbs to the coated protein was detected via their EPEA-tag using a 1:4000 CaptureSelectTM Biotin anti-C-tag conjugate (Thermo Fischer Scientific) in combination with 1:1000 Streptavidin Alkaline Phosphatase (Promega). Colour was developed by adding 100 µL of 3 mg/mL disodium 4-nitrophenyl phosphate solution (DNPP ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The CaptureSelect Biotin anti-C-tag Conjugate (LifeTechnologies #7103252100; 1/4000) was mixed with Streptavidin Alkaline Phosphatase (Promega #V5591; 1/1000 dilution) for 10 minutes before use ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs (2 μg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... rSARS-CoV-2/Δ7a-Nluc or rSARS-CoV-2/Nluc-2A infected cells was quantified using Nano-Glo® Luciferase Assay System (Promega) following the manufacturers’ specification.
-
bioRxiv - Molecular Biology 2023Quote: ... 1ng Luciferase Spike-In RNA (Promega), and 1X protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μg of the spike SARS2 (D614G)-pCAGGS (Medicines & Healthcare Products Regulatory Agency CFAR100985) using FugeneHD (Promega) transfection reagent at a ratio of 1:3 DNA:Fugene in optiMEM (Gibco) ...
-
A rare variant on a common risk haplotype of HFE causes increased risk of hereditary hemochromatosisbioRxiv - Genetics 2019Quote: ... or HEK293 cells using Fugene 6 (Promega) following manufacturer’s instructions and studied 48-72 hours post-transfection.
-
bioRxiv - Developmental Biology 2022Quote: ... and Klf4 vectors were co-transfected with pCL-Eco (Addgene ID 12371)149 in HEK293 cells with FuGENE6 (Promega) using low volume transfection protocol (Steffen et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... spike-in λ-DNA (Promega, Cat D150A) was added at a mass ratio of 1/200 ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μg of psPAX2 packing plasmid and 2 μg of pM2G envelope plasmid were transfected into HEK293 Lenti-X cells using 30 μL of Fugene-HD (Promega) in antibiotic-free DMEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 cells were transfected with Fugene 6 (Promega). All other cell lines were transfected using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... into HEK293 using FuGENE 6 transfection reagent (Promega). Culture supernatant containing lentiviral particles was harvested after 24-48h incubation and passed through a 0.45 μm filter ...
-
bioRxiv - Microbiology 2021Quote: ... anti-Halo-tag (Promega), anti-FLAG (M2 ...