Labshake search
Citations for Promega :
1 - 50 of 2567 citations for SARS CoV 2 Spike E M Mosaic Protein His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 293T cells were co-transfected with pEGFP-N1 and plasmids expressing SARS-CoV-2 Spike (FL) or SARS-CoV-2 Spike-Δ19 for 24 h using FugeneHD (Promega). The cells were treated with DMSO or 10 µM 6-TG at 4 h post- transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Microbiology 2022Quote: ... and a spike-expressing plasmid (pCAGGS-SARS-CoV-2-spike) were co-transfected into HEK293T cells using Fugene HD transfection reagentia (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: The SARS-CoV-2 spike pseudotyped virus activity was determined by bright-glo luciferase assay (Promega). The plate reader detected the luminescence two days post virus infection or without virus infection ...
-
bioRxiv - Genetics 2020Quote: ... Competent Escherichia coli cells (E. coli JM109; Promega, Fitchburg, USA) were incubated with the ligation mixture on ice for 30 min and then transformed by a 45 sec heat shock at 42 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 18h (SARS-CoV-2) or 24h (SARS-CoV) later by adding 1μM of Coelenterazine-H (Promega) at 1:400 dilution in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Buffer E (Promega) was added in cDNA and heated at 95 °C for 2 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Insulator1 and Insulator2 or Ins-E and cHS4-E were co-transfected with phRL-TK (Promega) at a ratio of 10:1 (0.8 ug ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids were eluted with RNase free water and used as templates for in vitro gene expression (E. coli S30 Extract System for Circular DNA, Promega).
-
bioRxiv - Synthetic Biology 2021Quote: ... Plasmids were resuspended in RNase-free water and used as templates for in vitro gene expression (E. coli S30 Extract System for Circular DNA, Promega). Reactions were set up by adding 1 μL of 0.25 mM amino acid mix ...
-
bioRxiv - Microbiology 2022Quote: ... either with SARS-CoV-2 S and Jun or with ACE2 and Fos plus the pRL Renilla Luciferase (Promega) to normalize the signal ...
-
bioRxiv - Microbiology 2023Quote: The effect of pyocin SX2 on protein synthesis was assessed by an in vitro transcription-translation assay (E. coli T7 S30 Extract System for Circular DNA. Promega, Germany). pRL-SV40 vector (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... supernatant was collected and purification was done via His-tag using HisLink Protein Purification Resin (V8823, Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Cell Biology 2019Quote: ... Plat-E cells were transfected with FuGENE™ HD (Promega) and transfection regent was incubated overnight before a media change ...
-
bioRxiv - Microbiology 2020Quote: ... or pNL-Luc2-E--IN/HiBiT-Fin using FuGENE6 (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Plat-E cells were transfected with FuGENE™ HD (Promega) and transfection regent was incubated overnight before a media change ...
-
bioRxiv - Immunology 2021Quote: The effect of neutralization capacity of Multivalent DARPin was evaluated by exposing serial dilutions of the DARPin candidates to increasing titers of SARS-CoV-2 and determining cell protection by CellTiter-Glo assay (Promega, Madison, USA). Serial dilution of DARPin candidates were prepared in 96 well plates in 100 µl cell culture medium (2%-FBS-MEM + HSA ...
-
bioRxiv - Microbiology 2022Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used in this study were as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 500 ng of either HDM-SARS-Spike-delta21 or HDM_Spike_RBD_B7-1 plasmids and 1.5 ng of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of the Halo-tag protein (Promega), with the insertion of a 45-base linker (15 amino acids ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3xFlag-m-PKD1-2xMyc/His insert was subcloned into pCI vector (Promega). To produce CTF expression constructs of human (h ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: Proteins bound to beads were reduced with 2 mM DTT in 2 M urea buffer and sequencing grade trypsin (Promega) was added to a final concentration of 5 ng/μl ...
-
bioRxiv - Microbiology 2023Quote: ... 800 ng pNL4.3.Luc.R-.E– (NIH Reagents program) and 200 ng pRL Renilla (Promega E2231) as control for nucleofection efficiency ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of the Halo 7-tag protein (Promega), with the insertion of a 63-base linker (21 amino acids ...
-
bioRxiv - Immunology 2020Quote: ... In vitro transcribed RNA derived from plasmid “pCI/SARS-CoV envelope” was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega), then purified by phenol/chloroform extractions and two successive precipitations with isopropanol and ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were further diluted to a final urea concentration of 2 M and proteins digested with trypsin (Promega) (1/100 ...