Labshake search
Citations for Promega :
1 - 50 of 1022 citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... binding was performed between the soluble fraction (supernatant) and glutathione-conjugated magnetic beads (Promega) pre-equilibrated with lysis buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Cell Biology 2023Quote: ... 10mM Ultrapure ATP and 0.7 μg of recombinant full-length human CDC7/DBF4 kinase (Promega, V5088). Reactions were incubated at 37 °C for 120 min and then terminated by freezing on dry ice before mass spectrometry.
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Plant Biology 2019Quote: ... Soluble cell extracts were added to MagneGST beads (Promega) and incubated and washed as described in Bartlet et al ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Cell Biology 2019Quote: ... cell viability was assessed by adding soluble formazan (MTS assay, Promega) and incubating for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... were then added to the 3’ ends of all fragments by incubation of 3 µg of size-selected DNA fragments with the recombinant terminal deoxynucleotidyl transferase (rTdT, 30 U/µL, Promega) at 37°C for 1H ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant (rTdT) enzyme (Promega). Cells were then incubated at 37 °C for 60 min ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... of SNHG16 sequence and the 3’-untranslated region (UTR) fragment of STARD9 containing miR-1301-3p binding site were subcloned into the pmirGLO vectors (Promega, Madison, WI, USA) to generate SNHG16-Wt/Mut vectors and STARD9-Wt/Mut vectors ...
-
bioRxiv - Microbiology 2022Quote: ... The clarified soluble protein suspension was purified using MagneGST Glutathione Particles (Promega) according to manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lectins were independently tested for cellular toxicity in an ATP-dependent assay (Cell-Titer Glo, Promega) and cells found to exhibit >80% viability up to a concentration of 200 μg/ml (data not shown).
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Neuroscience 2020Quote: ... 1U/uL recombinant RNAsin(Promega), 10mM Na3VO4 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNasin Ribonuclease inhibitor (Promega), and SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and recombinant RNasin inhibitor (Promega). The transcripts for genes of interest were measured by real-time qPCR with a Lightcycler 480 II system (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant GST-tagged MARK2 (Promega) was incubated with tau at 30 °C at 1:100 ratio of MARK2:tau in phosphorylation buffer (25 mM PIPES ...
-
bioRxiv - Neuroscience 2023Quote: ... and ribonuclease (RNasin Recombinant, Promega) at concentrations of 1:1000 (sucrose buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Halo-tagged ubiquitin-binding domains (UBDs) of TUBE (tandem-repeated ubiquitin-binding entities) was incubated with HaloLink resin (200 μL, Promega) in binding buffer (50 mm Tris⍰HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.625 μl of recombinant RNasin (Promega), 1 μl of random hexamer primers (Promega ...
-
bioRxiv - Physiology 2019Quote: ... 100 U/mL recombinant RNasin (Promega), 100 μg/mL cycloheximide ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2U/μL Recombinant RNAsin (Promega, PAN2515), 1% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Physiology 2023Quote: ... the oligo with NF-κB consensus binding element (Promega) was end-labeled by T4 polynucleotide kinase (Promega ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 units of recombinant RNAsin (Promega®) and 1 unit/μl Avian Myoblastosis virus reverse transcriptase (Promega® ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... Ultra-Glo recombinant luciferase (Promega, Wisconsin, USA) was added to the media to determine ATP levels ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant RNase inhibitor (0.2 U/μl; Promega, 2% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2023Quote: ... Luciferase refolding assay: QuantiLum Recombinant Luciferase (Promega) was diluted to 55 µM in denaturation buffer containing 6M Guanidium/HCl and 1 mM DTT during 30 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 1U/μL Recombinant RNase inhibitor (Promega, PAN2515), and 0.1% Triton X-100) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Vero cells were incubated with 10 μM of the MEK-specific inhibitor U0126 (DMSO soluble, Promega).
-
bioRxiv - Biochemistry 2020Quote: ... recombinant Trypsin was purchased from Promega (WI. USA), Indium-tin-oxide (ITO ...