Labshake search
Citations for Promega :
1 - 50 of 1396 citations for Recombinant Human HPRT1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified using MagneHis nickel particles (Promega, WI), then dialyzed against EMSA buffer (50mM Tris-HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... several concentrations of purified recombinant HaloTag protein standard (Promega, G4491) were labeled with ligand and run in duplicate to generate a calibration curve ...
-
bioRxiv - Immunology 2024Quote: Recombinant antibodies were purified using protein G magnetic beads (Promega #G7472), HiTrap protein G HP columns (Cytiva #17040401) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant proteins were purified with MagneGST™ Protein Purification System (www.promega.com/protocols/; Promega, Madison, WI, USA).
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant GST-OsNAC5 fusion protein was subsequently purified with the MagneGST™ Protein Purification System (Promega), following the provided protocol.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were reduced and alkylated prior to digestion with recombinant LysC (Promega) and trypsin (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were reduced and alkylated prior to digestion with recombinant LysC (Promega) and trypsin (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Cell Biology 2023Quote: ... 10mM Ultrapure ATP and 0.7 μg of recombinant full-length human CDC7/DBF4 kinase (Promega, V5088). Reactions were incubated at 37 °C for 120 min and then terminated by freezing on dry ice before mass spectrometry.
-
bioRxiv - Developmental Biology 2019Quote: ... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Biochemistry 2024Quote: ... The HaloTag-JF503-SWSAP1 was quantified by using recombinant HALO-GFP protein standard (Promega) pre-incubated with JF503 at a 1:1 molar ratio and titrated into single molecule buffer (20 mM Tris pH7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Systems Biology 2019Quote: Cells were lysed and recombinant proteins were isolated using Magne® HaloTag® Beads (Promega) as previously described (15) ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Systems Biology 2020Quote: ... albicans as well as of a commercially available human protein digest (Promega), which was exclusively used in this experiment ...
-
bioRxiv - Biochemistry 2023Quote: MS-Compatible Human Protein Extract Digest (K562) was purchased from Promega (V6951), MassPREP E ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged and GST-tagged recombinant proteins were purified using Promega MagneHis™ Ni-Particles (Promega Cat#V854A) and MagneGST™ Glutathione Particles (Promega Cat# V861A ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant (rTdT) enzyme (Promega). Cells were then incubated at 37 °C for 60 min ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Plant Biology 2024Quote: ... and the recombinant protein was produced using a TNT SP6 Coupled Wheat Germ Extract System (Promega, Madison, WI, USA). Magne Halo Tag Beads (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... 1U/uL recombinant RNAsin(Promega), 10mM Na3VO4 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNasin Ribonuclease inhibitor (Promega), and SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant GST-tagged MARK2 (Promega) was incubated with tau at 30 °C at 1:100 ratio of MARK2:tau in phosphorylation buffer (25 mM PIPES ...
-
bioRxiv - Immunology 2023Quote: ... and recombinant RNasin inhibitor (Promega). The transcripts for genes of interest were measured by real-time qPCR with a Lightcycler 480 II system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and ribonuclease (RNasin Recombinant, Promega) at concentrations of 1:1000 (sucrose buffer ...
-
bioRxiv - Microbiology 2023Quote: 1 ml of recombinant GST or GST-YgfB protein at a concentration of 10 μM was incubated with 100 μl 50 % MagneGST (Promega) bead-slurry equilibrated with pulldown-buffer for 45 min at 4°C and washed two times with 500 μl pulldown-buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.625 μl of recombinant RNasin (Promega), 1 μl of random hexamer primers (Promega ...
-
bioRxiv - Physiology 2019Quote: ... 100 U/mL recombinant RNasin (Promega), 100 μg/mL cycloheximide ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2U/μL Recombinant RNAsin (Promega, PAN2515), 1% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2021Quote: ... Pull down assays were performed utilizing myc-tagged proteins that were generated from recombinant pGBKT7-derivatives through in vitro transcription/translation using wheat germ extract (cat# L4330, Promega, Madison, WI, USA)(Stephan et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 units of recombinant RNAsin (Promega®) and 1 unit/μl Avian Myoblastosis virus reverse transcriptase (Promega® ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... Ultra-Glo recombinant luciferase (Promega, Wisconsin, USA) was added to the media to determine ATP levels ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant RNase inhibitor (0.2 U/μl; Promega, 2% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2023Quote: ... Luciferase refolding assay: QuantiLum Recombinant Luciferase (Promega) was diluted to 55 µM in denaturation buffer containing 6M Guanidium/HCl and 1 mM DTT during 30 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 1U/μL Recombinant RNase inhibitor (Promega, PAN2515), and 0.1% Triton X-100) ...
-
bioRxiv - Biochemistry 2020Quote: ... recombinant Trypsin was purchased from Promega (WI. USA), Indium-tin-oxide (ITO ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 30 μL Recombinant RNasin Ribonuclease Inhibitor (Promega). Ten milligrams of protein was incubated with 4 μL α-myc antibody (Sigma M4439 ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of recombinant RNase inhibitor (Promega) and concentration was determined (Nanodrop 2000 spectrometer ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 U/μl Recombinant RNasin Ribonuclease Inhibitor (Promega), 45 mM sodium chloride ...
-
bioRxiv - Biochemistry 2023Quote: OuantiLum® Recombinant Luciferase was purchased from Promega. Creatin Kinase from rabbit muscle was purchased from Sigma Aldrich.