Labshake search
Citations for Promega :
1 - 50 of 5689 citations for Rat Phosphoprotein associated with glycosphingolipid enriched microdomains 1 PAG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and associated Maxwell RSC cultured cells DNA kit (Promega). DNA concentration was quantified using the Qubit 3.0 fluorometer for dsDNA broad range assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 min at 60°C) an alkylation (IAA 0.5M, 30 min RT) microtubule-associated protein enriched fractions were digested using trypsin (Gold, Promega, 1 μg / sample, overnight at 30°C). Peptide clean-up was done using OMIX C18 (Agilent ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 unit T4 ligase with associated buffer (Promega). The following thermocycler program was run ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Molecular Biology 2022Quote: ... The labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone (Promega) either directly from gDNA (using overhang-containing primers ...
-
bioRxiv - Microbiology 2023Quote: ... enriched proteins were eluted by adding 1µg trypsin (Promega) and incubation for 30min at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: Aggregates-enriched fractions were enzymatically digested using trypsin (V542A, Promega), α-Chymotrypsin (referred as Chymotrypsin in the text ...
-
bioRxiv - Microbiology 2022Quote: ... enriched proteins were digested on-bead with trypsin (Promega, V5111). Peptides were acidified with 0.5% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: Activity of predicted labor-associated TF candidates was assayed using a dual luciferase reporter assay (Promega). On Day 0 ...
-
bioRxiv - Molecular Biology 2023Quote: Activity of predicted labor-associated TF candidates was assayed using a dual luciferase reporter assay (Promega) as done previously (8) ...
-
bioRxiv - Microbiology 2021Quote: Peptides from cell-surface/biofilm-ECM-associated proteins were released via a Trypsin/Lys-C mix (Promega) at a final concentration of 50 ng µL-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... The proteins enriched by neutravidin beads were digested with MS-grade trypsin (Promega). The on-beads digested peptides were collected and desalted by the in-house prepared reversed phase C18 Stage-tip ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 was detected by indirect sandwich amide chemiluminescence ELISA using a luminescence plate reader (GloMax Promega, USA). This total GLP-1 assay detects GLP-1 (7-36 ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 g of the muscle lysates were used for determining proteasome-associated chymotrypsin-like activity with the Proteasome-GloTM Assay Systems (#G8531, Promega). Luminescence signals were detected with the SpectraMax i3x Multi-Mode Microplate Reader (Molecular Devices ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 ml of culture supernatants were collected every 6 hours and nanoluciferase activities associated with released virus in the supernatants were measured using Nano-Glo luciferase assay system (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... Baseline fluorescence was measured in an ELISA reader (Promega) following an incubation of 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: PolyA-enriched RNA was extracted using PolyATract mRNA isolation systems (#Z5310 Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Enriched DNA fragments were amplified and cloned using the pGEM-T easy vector (Promega, Madison, USA) and transformed into XL1-BLUE Escherichia coli competent cells (Stratagene ...
-
bioRxiv - Cell Biology 2023Quote: ... Presence of rat cells in myoblast culture/muscle lysate was assessed by PCR for rat dystrophin using primers Rat Dmd i22-i23.F/ Rat Dmd i22-i23.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Physiology 2020Quote: ... The transferase dUTP Nick End Labeling (TUNEL) assay was performed on cryosections of rat eyes using the TUNEL apoptosis detection kit (DeadEnd Fluorometric TUNEL System; Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... ELISA plates were read on a GloMax plate reader (Promega, Wisconsin, US). Data were converted from concentration to total mass based on the volume of media/pellet ...
-
bioRxiv - Genomics 2021Quote: The total amount of enriched DNA released from the dMDA droplets was measured with Quantus™ Fluorometer (Promega Inc.) and fragment size distribution was inspected on TapeStation™ (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti-Fat (kind gift from Helen McNeill) was used at 1:500 and mouse anti-β-galactosidase (Z3781, Promega; RRID:AB_430877) was used at 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Microbiology 2021Quote: Luminescence measurements were performed using percoll-enriched infected erythrocytes in 384 well microplates using the Nano-Glo HiBiT extracellular detection system (Promega). Cells were resuspended at 0.2% hematocrit in culture medium diluted with two volumes of 200:1:50 buffer:LgBiT:Furimazine ...
-
bioRxiv - Cell Biology 2023Quote: ... in-gel digestion was performed on the PNS and enriched peroxisomal membranes using 300 ng trypsin (sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins as described previously (Wolters et al. ...
-
bioRxiv - Immunology 2020Quote: ... Total IgG and ANA ELISA plates were read using a GlowMax Discover Microplate Reader (Promega) on the absorbance setting at 450nm.
-
bioRxiv - Immunology 2022Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega) at 450nm absorbance.
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Biophysics 2020Quote: ... The construct expresses rat GR fused with HaloTag protein (Promega, Madison, WI, USA) in the C-terminal domain under the CMVd1 promoter ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Cell Biology 2019Quote: ... Cell signalling) or rabbit anti-TgTOM40 (1:2000, (van Dooren et al., 2016)) antibodies coupled to secondary horseradish peroxidase (HRP)(Promega for mouse and rabbit, Abcam for rat) conjugated antibodies (1:10,000 ...
-
bioRxiv - Immunology 2022Quote: Caspase-1 activity was quantified using a Caspase-Glo 1 Inflammasome Assay kit (Promega, Madison, WI). THP-1 cells were treated and harvested as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... Rat Gβ1 was cloned with a C-terminal SmBiT34 (peptide 86 or HiBiT, Promega) connected with a 15AA polypeptide linker ...
-
bioRxiv - Biophysics 2022Quote: The pHaloTag-GR plasmid expresses rat GR fused to HaloTag (Promega, Madison, WI, USA) in the C-terminus regulated by a CMVd1 promoter and has been described previously (57) ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat C/EBP□-LIP or -LAP containing pcDNA3 or pSV2Zeo vector by using FugeneHD (Promega) according to the manufactures protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.