Labshake search
Citations for Promega :
1 - 50 of 5673 citations for Rat Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 was detected by indirect sandwich amide chemiluminescence ELISA using a luminescence plate reader (GloMax Promega, USA). This total GLP-1 assay detects GLP-1 (7-36 ...
-
bioRxiv - Cell Biology 2022Quote: ... Baseline fluorescence was measured in an ELISA reader (Promega) following an incubation of 30 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Presence of rat cells in myoblast culture/muscle lysate was assessed by PCR for rat dystrophin using primers Rat Dmd i22-i23.F/ Rat Dmd i22-i23.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Physiology 2020Quote: ... The transferase dUTP Nick End Labeling (TUNEL) assay was performed on cryosections of rat eyes using the TUNEL apoptosis detection kit (DeadEnd Fluorometric TUNEL System; Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... ELISA plates were read on a GloMax plate reader (Promega, Wisconsin, US). Data were converted from concentration to total mass based on the volume of media/pellet ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti-Fat (kind gift from Helen McNeill) was used at 1:500 and mouse anti-β-galactosidase (Z3781, Promega; RRID:AB_430877) was used at 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Immunology 2020Quote: ... Total IgG and ANA ELISA plates were read using a GlowMax Discover Microplate Reader (Promega) on the absorbance setting at 450nm.
-
bioRxiv - Immunology 2022Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega) at 450nm absorbance.
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... The construct expresses rat GR fused with HaloTag protein (Promega, Madison, WI, USA) in the C-terminal domain under the CMVd1 promoter ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Cell Biology 2019Quote: ... Cell signalling) or rabbit anti-TgTOM40 (1:2000, (van Dooren et al., 2016)) antibodies coupled to secondary horseradish peroxidase (HRP)(Promega for mouse and rabbit, Abcam for rat) conjugated antibodies (1:10,000 ...
-
bioRxiv - Immunology 2022Quote: Caspase-1 activity was quantified using a Caspase-Glo 1 Inflammasome Assay kit (Promega, Madison, WI). THP-1 cells were treated and harvested as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... Rat Gβ1 was cloned with a C-terminal SmBiT34 (peptide 86 or HiBiT, Promega) connected with a 15AA polypeptide linker ...
-
bioRxiv - Biophysics 2022Quote: The pHaloTag-GR plasmid expresses rat GR fused to HaloTag (Promega, Madison, WI, USA) in the C-terminus regulated by a CMVd1 promoter and has been described previously (57) ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat C/EBP□-LIP or -LAP containing pcDNA3 or pSV2Zeo vector by using FugeneHD (Promega) according to the manufactures protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Neuroscience 2019Quote: CHO-K1 cells (ATCC, cultured as described above) were transfected with rat TRAAK-GFP with FugeneHD (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg cellular RNA was treated with DNase (RQ1 Rnase-Free DNase kit Promega) and reverse-transcribed following the GoScript ™ Reverse Transcriptase Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Systems Biology 2024Quote: ... coagulans DSM 1 = ATCC 7050 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed with PBS and inflammasome activation was assessed using qPCR or inflammasome caspase-1 activity was measured using Caspase-Glo® 1 inflammasome assay kit (G9951; Promega) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit, Promega). Quantitative RT-PCR was performed using FluoCycle II SYBR Master Mix (EuroClone ...
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2019Quote: ... The U6 reporter construct was assembled by ligating a 663bp rat U6 sequence into the HindIII and NheI sites of the pGL4.23 vector (Promega) upsteam of the minimal promoter in this vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA was synthesized using 1 µg total RNA with MMLV Reverse Transcription Kit (Promega) and poly-T primer ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative Realtime PCR (qRT-PCR) was performed using GoTaq® 1-Step RT-qPCR kit (Promega) with primers specific for PEX1 (RE7039-RE7040 ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate RNA standard ...