Labshake search
Citations for Promega :
1 - 50 of 874 citations for NT 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA (>200 nt) and small RNA concentrations were measured with a QuantiFluor® RNA System (Promega). RNA (>200 nt ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the 82-nt exon 11 of the MAPT gene was constructed in the pCI-neo vector (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... and a 982bp fragment of Gad1 (Corresponding to nt 1015-1996 of NM_008077.2) were PCR-cloned into pGEM Easy T vector (Promega).
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Molecular Biology 2023Quote: ... S0ng of parental plasmid was amplified with complementary 35nt-long forward and reverse primer pairs (0.25uM each) containing the desired nucleotide substitution (at nt position 17) in the presence of 1.25U Pfu DNA polymerase (Promega) and 200uM dNTPs (each ...
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: HEK293 cells growing at 70% confluency in a 10 cm dish were transfected with wild-type human NOPR or NOPLight (3 µg DNA) and GloSensor-20F (Promega, 2.5 µg DNA) using 12 µL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Immunology 2022Quote: ... and a non-target control (NT-Ctrl) along with the packaging plasmids (pHCMV-G, and pHCMV-HIV-1) (44) using FUGENE-HD transfection reagent (Promega). The mouse Drp1-targeted shRNA plasmid with the sense sequence of GGCAATTGAGCTAGCTATA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... The 145-160 bp bands (which correspond to inserts of 24-32 nt cDNAs) were extracted and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). The quality of the library was assessed by the Experion DNA 1K chips (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the nucleocapsid subsequence starting from the start (ATG) of the nucleocapsid ORF to the ending 25-nt poly-A was cloned into a pGEM-7Zf(+) vector (Promega; P2251) by XbaI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL RNasin (Promega) and 100 µL lysis buffer for a total volume of 300 µL for IP by rotation for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... treated with 3 mM dithiothreitol (DTT) (molecular grade, Cat. 3483-12-3, Promega), and incubated for 30 min at 37°C in 5% CO2 in serum-free RPMI media ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase-3 and -7 activity was measured by Caspase-Glo 3/7 Assay (Promega) according the manufacturer’s instructions using a BioTek Synergy H1 plate reader.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega) and caspase activity was normalized to cell number by performing the CellTiter-Glo Luminescent Cell Viability Assay on the duplicate plate.
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega), and caspase activity was normalized to cell number by performing the CellTiter Glo Luminescent Cell Viability Assay on the duplicate plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and -7 activities were measured by Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... Caspase-3/7 activities were measured using Caspase-Glo 3/7 Assay kits (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μg of purified RNA was incubated with 3 units of RQ1 DNase (Promega) at 37°C for 30 mins ...
-
bioRxiv - Bioengineering 2021Quote: Caspase 3/7 activity was measured using the Caspase-Glo 3/7 assay (Promega). Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... caspase 3 activity was measured using Caspase-Glo 3/7 assay (Promega, Alexandria, Australia). Quantification of viable cells was performed by staining with 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 Glo (Promega) was used to measure caspase 3/7 cleavage ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 units/mL RNasin (Promega). Depending on the experiments (see results) ...
-
bioRxiv - Microbiology 2020Quote: ... caspase-3/7 activity was quantified using the Caspase-Glo-3/7 assay system (Promega). Luminescence was quantified using plate reader Synergy H1 Hybrid Reader (BioTek).
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-3/7 activity was measured using Caspase-Glo 3/7 Assay Systems (G8091, Promega) according to the manufacturer’s protocol.