Labshake search
Citations for Promega :
1 - 50 of 4075 citations for NGS ChIP Seq kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Ovation Methyl-Seq kits to prepare RRBS libraries (with added Promega unmethylated cl857 Sam7 lambda control spike-in of 1 ng per 80-120 ng of sample) ...
-
bioRxiv - Microbiology 2020Quote: ... ProNex® NGS Library Quant Kit (Promega Corporation) was used for library quantification prior to sequencing on a MiSeq® instrument ...
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... 20 ng/μL LysC and 10 ng/μL Trypsin (Promega) were added to each sample and incubated for 16 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ChIP-qPCR was performed using GoTaq qPCR Master Mix (Promega) with a StepOnePlus™ Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: cDNA was synthesized from 1000 ng of RNA using the GoScript Reverse Transcriptase kit (Promega) according to the manufacturer’s description with random hexamer primers and a final MgCl2 concentration of 5 mM ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized using 200 ng total RNA by the Reverse Transcription kit (Promega, Madison, USA) according to the instruction ...
-
bioRxiv - Bioengineering 2021Quote: ... and 250 ng were processed by in vitro transcription using the HiScribe T7 kit (Promega, E2040S) and incubated at 37 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis from 500 ng RNA was performed using the GoScript Reverse Transcriptase kit (Promega #A2801). Real-time (RT)-polymerase chain reaction (PCR ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... 50 ng PPRE X3-TK-luc and 6 ng pRL-SV40 (Promega), in the presence of the Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 125 ng pAdvantage (Promega), 1 μg Luciferase reporter (per 6-well plate) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 ng LysC (Promega)) was added and then vortexed in 30 °C for 2 h ...
-
bioRxiv - Systems Biology 2020Quote: ... 500 ng trypsin (Promega) for 30 min at room temperature on a mixer (Eppendorf) ...
-
bioRxiv - Biochemistry 2024Quote: ... 840 ng trypsin (Promega) in 30 μL ABC was added to each tube ...
-
bioRxiv - Neuroscience 2021Quote: ... Bulk RNA-seq samples were treated with RQ1 RNase-free DNase (Promega) prior to library preparation ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 500 ng of total RNA was used to generate cDNA using GoScript Reverse Transcriptase kit (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... 500 ng of total RNA were reverse transcribed using the GoScript Reverse transcription system kit (Promega, USA), following manufacturer instructions and cDNA samples were then stored at - 20°C until further use.
-
bioRxiv - Pathology 2021Quote: ... 100 ng/well indicated plasmids and 10 ng pRLTK internal control vector (Promega) were co-transfected with 1.25 μl Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Concentration of ChIP-nexus libraries was measured using the Quantus fluorometer (Promega) and fragment size distribution was checked on Agilent Bioanalyzer using the High Sensitivity DNA Assay ...
-
bioRxiv - Microbiology 2022Quote: 293A cells were seeded into 20-mm wells of 12-well cluster dishes with or without glass coverslips and the next day transfected with 500 ng DNA mixes/well containing expression vectors (250 ng) and pUC19 filler DNA (250 ng) using Fugene HD (Promega, Madison, WI, USA) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and digestion with 250 ng of LysC (Wako) or 250 ng of LysN (Promega) at 37°C for 16 h ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 ng pGL4.10[luc2] reporter plasmid and 2.5 ng TK-Renilla plasmid (Promega; E2241) (transfection control) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reporter plasmid (500 ng) and Renilla phRL-TK control vector (50 ng; Promega E2241) were cotransfected into HEK293T cells cultured in DMEM containing 10% FBS using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen 15338100) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Microbiology 2020Quote: RNA (400 ng) was reverse transcribed into cDNA using random oligos and the GoScript Reverse Transcriptase kit (Promega). The cDNA was probed using primers specific to target genes in the StepOnePlus Real Time PCR system as described above ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 100-500 ng of total RNA using the GoScript reverse transcription reaction kits (Promega). Singleplex quantitative real-time polymerase chain reaction (qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... 800 ng of total RNA were freed from genomic DNA using the RQ1 RNase-Free DNase Kit (Promega). Reverse transcription was performed using 145,4ng of the total DNase-treated RNA using the TaKaRa PrimeScript RT Master Mix Kit ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng lambda DNA (Promega) was spiked into 1 µg genomic DNA quantified using Qubit fluorometry and arrayed in a 96-well microtitre plate ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... 50 ng pG5-luc (Promega) reporter plasmid and 6 ng pRL-SV40 (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and trypsin (100 ng; Promega). We mixed the resulting peptides with a MALDI matrix consisting of an aqueous 50% acetonitrile/0.1% TFA solution of α-cyano-4-hydroxycinnamic acid (5 mg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... Trypsin (6 ng/ml, Promega) in NH4HCO3 (50 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 ng Random Primers (Promega), 400 ng Anchored Oligo (dT)20 Primer (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... chymotrypsin (12.5 ng/µl, Promega), ArgC (12.5 ng/µl ...
-
bioRxiv - Genomics 2020Quote: ... ArgC (12.5 ng/µl, Promega) or elastase (20 ng/µl Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml NGF (Promega)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 ng pRL-SV40 (Promega), and 375 ng total amount of testing plasmids individually or in combinations ...
-
bioRxiv - Microbiology 2023Quote: ... then 200 ng trypsin (Promega), diluted in 80 µL of 20 mM ammonium bicarbonate buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 ng or 50 ng pRL-SV40 Renilla luciferase reporter vector (Promega, Madison, WI, USA) was co-transfected ...
-
bioRxiv - Microbiology 2023Quote: ... 800 ng pNL4.3.Luc.R-.E– (NIH Reagents program) and 200 ng pRL Renilla (Promega E2231) as control for nucleofection efficiency ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from 400 ng of RNA using ImProm-II Reverse Transcription system kit and random primers (Promega). Quantitative PCR was performed in technical duplicates using SensiMix SYBR mix (Bioline) ...
-
bioRxiv - Cancer Biology 2019Quote: ... A total of 500 ng RNA was reverse-transcribed to cDNA using the Reverse Transcription Kit (Promega, Madison, USA), according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Biochemistry 2021Quote: ... along with Renilla luciferase (50 ng of pGL4.70[hRluc] or 1 ng of pRL-null; Promega), and pCI expression vector encoding either FL-PC1 ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were transfected with 100 ng pGL3-RARE-luciferase and 10 ng pRL Renilla (Promega E2261) using Mirus TransIT-2020 Transfection Reagent (Mirus MIR 5404 ...
-
bioRxiv - Immunology 2023Quote: ... 1 ng pEF1α-Renilla and 130 ng plasmid of interest and 0.66 µl FuGENE HD (Promega) diluted to 10 µl total volume with OptiMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR on cDNA or ChIP DNA was performed with GoTaq qPCR Master Mix (Promega) under the manufacturer’s instruction on a QS5 system (Thermo Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... 200 ng/sample trypsin (Promega, V5111), 200 ng/sample Lys-C (FUJIFILM Wako ...