Labshake search
Citations for Promega :
1 - 50 of 3668 citations for Myc Box Dependent Interacting Protein 1 BIN1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Pull down of Halo-PfSR1 interacting proteins was performed using the HaloTag® Protein Purification System (Promega, cat # G1913) according to the manufacturer guidelines ...
-
bioRxiv - Biochemistry 2024Quote: ... thus not interacting with proteins of mammalian origin) that was fused with the small NanoLuc subunit (Promega).
-
bioRxiv - Molecular Biology 2019Quote: ... and PERP plus any interacting proteins were cleaved from the resin using 30 units of ProTEV enzyme (Promega) at room temperature for one hour (elution 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... 22F cAMP dependent reporter plasmid (Promega), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... HCT116 cells expressing the auxin-responsive F-box protein Oryza sativa TIR1 (OsTIR1) under the control of a Tet promoter were transfected using FuGENE HD (Promega) with a CRISPR/Cas9 plasmid targeting nearby the 1st ATG codon of the RIF1 gene (5’-TCTCCAACAGCGGCGCGAGGggg-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Antibody-dependent cell-mediated cytotoxicity (ADCC) was assessed by an ADCC Reporter Bioassay (Promega, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... SRE-dependent firefly luciferase (95ng; Promega; E1340) 60 ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of 25 uL/well of Antibody Dependent Cellular Cytotoxicity (ADCC) Bioreporter Cells (Promega cat# G7010). The ADCC Bioreporter cells are engineered Jurkat cells stably expressing FcγRIIIa V158 (high affinity ...
-
bioRxiv - Plant Biology 2022Quote: ... EMF2 and POT1a proteins) or a myc-tag (pGBKT7-DEST; TRB proteins) using a TNT Quick Coupled Transcription/Translation system (Promega) in 50 μl reaction volumes according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... cAMP-dependent GloSensor reporter plasmid (−22F cAMP plasmid, Promega, E2301), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Ca2+-dependent nuclear factor of activated T-cells (NFAT) (pGL4.30; Promega), or the MAPK signaling pathway (pGL4.33 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-dependent interactions were assessed by treating nuclear extracts with 1 U/μl RNasin® Ribonuclease Inhibitors (Promega, # N2615) as control or 1 mg/ml of RNase A (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Myc-tagged DHX36 was constructed by inserting the ORF of DHX36 into pCMV-Myc (Promega). pHAGE-WT and -D126A DDX21 were constructed by inserting the flag-tagged WT and D126A DDX21 into pHAGE-bsd ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using a phenol-based extraction protocol (Box et al., 2011) followed by DNAse (Promega) digestion at 37°C to remove the genomic DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... Zc3h18-3F-mAID mES cells were transfected with pB-MYC-mZC3H18x-BSD vectors along with a piggyBAC transposase expressing vector (pBase) in a 1:1 ratio using Viafect (Promega). Cell pools were selected with BSD for ∼ 7-10 days or until negative control cells no longer survived ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG) or subcloned into a pHTC (Promega)-derived vector that expresses C-terminal HaloTag (41) ...
-
bioRxiv - Cell Biology 2022Quote: ... together with the integration vectors for AtAFB2-Myc and AtAFB2-Myc-NLS (based on a vector kindly provided by Elina Ikonen) using FuGene HD transfection reagent (Promega). Puromycin (5 µg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... and the ATP dependent CellTiter-Glo® 2.0 Cell Viability Assay (#G9241, Promega, Dübendorf, Switzerland) according to the manufacturer procedure respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... we examined the downstream cAMP-dependent CREB-luciferase reporter system (pGL4.29 [luc2P/CRE/Hygro]; Promega). HEK293T or A cells were maintained in DMEM (InVitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... were cloned into pcDNA3.1-myc-His plasmid (Promega). For sequencing we used a sequence analyser (ABI Prism 3100 Avant ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein expression was confirmed by Western blot with Anti-Halo Tag monoclonal antibody (1:2000) (G9211, Promega).
-
bioRxiv - Synthetic Biology 2021Quote: ... we used a different cAMP-dependent firefly luciferase suitable for Gαi signaling (GloSensor-22F; Promega; E2301) 77 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lectins were independently tested for cellular toxicity in an ATP-dependent assay (Cell-Titer Glo, Promega) and cells found to exhibit >80% viability up to a concentration of 200 μg/ml (data not shown).
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein bands were detected with horseradish peroxidase (HRP)-conjugated rabbit or mouse secondary antibody [1:1,000 dilution] (Promega). The chemiluminescence signal was imaged using an Odyssey XF Imager (LI-COR ...
-
bioRxiv - Cell Biology 2021Quote: ... RPE1 cells were co-transfected with 1 µg KIF1C-mCherry-FRB and 0.5 µg FKBP-GFP-Myc-MAO using Fugene 6 (Promega) in fibronectin-coated glass-bottom dishes and imaged 24 hours later on an Olympus Deltavision microscope (Applied Precision ...
-
bioRxiv - Biochemistry 2021Quote: ... the sample was diluted 1:1 with 50 mM ammonium bicarbonate and proteins were digested with trypsin (protein to enzyme ratio 1:50, Promega, Mannheim, Germany) overnight at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The cell viability was investigated through the LDH dependent CytoTox 96 Non-radioactive Cytotoxicity assay (#G1780, Promega, Dübendorf, Switzerland.) and the ATP dependent CellTiter-Glo® 2.0 Cell Viability Assay (#G9241 ...
-
bioRxiv - Microbiology 2021Quote: ... and Tat-dependent increase of luciferase enzyme activity in cell lysates was determined with the Luciferase Assay system (Promega). Luminometric activity was analyzed with a Mithras luminometer.
-
bioRxiv - Bioengineering 2023Quote: ... Time-dependent bioluminescence was measured after glutamine addition using Nano-Glo® Dual-Luciferase® reporter assay system (Promega). Cell culture plates were equilibrated at 22 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... 11S protein was detected with a rabbit polyclonal antibody from Promega, and Tom40 with a rabbit polyclonal antibody produced by Cambridge Research Biochemicals (Billingham ...
-
bioRxiv - Immunology 2024Quote: Recombinant antibodies were purified using protein G magnetic beads (Promega #G7472), HiTrap protein G HP columns (Cytiva #17040401) ...
-
bioRxiv - Plant Biology 2019Quote: ... ATP content was deter-mined for each sample through ATP-dependent luciferase reaction (BacTiter-Glo Microbial Cell Viability Assay, Promega) as indicated by the manufacturer.
-
bioRxiv - Microbiology 2022Quote: ... Replicon activity was calculated as the ratio of Renilla (subgenomic reporter) to Firefly (co-transfected loading control RNA, cap-dependent translation) using Dual-Luciferase Stop & Glo Reporter Assay System (Promega) and normalized by the same ratio for the control WT replicon ...
-
bioRxiv - Microbiology 2022Quote: ... Replicon activity was calculated as the ratio of Renilla (subgenomic reporter) to Firefly (co-transfected loading control RNA, cap-dependent translation) using Dual Luciferase Stop & Glo Reporter Assay System (Promega) and normalized by the same ratio for the control wt replicon ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were digested with 1 µg trypsin (Promega) and subjected to liquid chromatography (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies were obtained in carrier/ protein-free buffer or were purified using the Magne Protein A or G Beads (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: HEK cells were transfected as previously described for the SRE reporter assay with the exception of substituting the SRE reporter with CRE-dependent firefly luciferase 60 (Promega; E8471).
-
bioRxiv - Cell Biology 2023Quote: ... wild-type and mutant tepsin-myc constructs were transfected using Fugene 4K (Promega) at 1.5:1 Fugene:DNA ratio following manufacturer protocol ...
-
bioRxiv - Biochemistry 2023Quote: Stable COMT cell lines were transfected with Myc-tagged ubiquitin using FugeneHD (Promega) following the manufacturer’s instructions using 4 μg plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... In-solution digestion was performed with LysC-Trypsin mix (1:100 enzyme: protein ratio) and trypsin (Promega; 1:50 enzyme: protein ratio). Peptides were desalted on C18 stage tips ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein production was confirmed by western blot using an anti-HaloTag antibody (Promega). HaloTag-ligand conjugated magnetic beads (Promega ...
-
bioRxiv - Physiology 2019Quote: ... Proteins were co-precipitated with 1 µg trypsin (Promega) overnight at −20 °C in 1 ml methanol ...
-
bioRxiv - Biochemistry 2022Quote: ... proteins were digested with 1) chymotrypsin (Promega, Madison, USA), 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Genetics 2024Quote: ... A 1:10 ratio (enzyme: protein) of Trypsin (Promega) and LysC (Wako ...
-
bioRxiv - Cell Biology 2024Quote: ... containing trypsin (Promega; final 1/100 enzyme/protein ratio) and LysC (Wako ...