Labshake search
Citations for Promega :
1 - 50 of 957 citations for IL 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
A rare variant on a common risk haplotype of HFE causes increased risk of hereditary hemochromatosisbioRxiv - Genetics 2019Quote: ... or HEK293 cells using Fugene 6 (Promega) following manufacturer’s instructions and studied 48-72 hours post-transfection.
-
bioRxiv - Developmental Biology 2022Quote: ... and Klf4 vectors were co-transfected with pCL-Eco (Addgene ID 12371)149 in HEK293 cells with FuGENE6 (Promega) using low volume transfection protocol (Steffen et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 cells were transfected with Fugene 6 (Promega). All other cell lines were transfected using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... into HEK293 using FuGENE 6 transfection reagent (Promega). Culture supernatant containing lentiviral particles was harvested after 24-48h incubation and passed through a 0.45 μm filter ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 autophagy reporter cells (HiBiT-HaloTag-LC3, Promega #GA1040) were grown in in DMEM (ThermoFisher #31053-028 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 were transiently transfected using Fugene HD (Promega, U.K.) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... HEK293 cells were transiently transfected using Fugene 6 (Promega) with GFP-Tnf 3’UTR reporter constructs and a pGL3-mCherry control construct ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293 cells cotransfected with pFN21A HaloTag CMV Flexi vector (Promega) expressing PALLD and pNLF1-N [CMV Hygro] or pNLF1-C [CMV Hygro] vector (Promaga ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 stably expressing pcDNA3.1(+)_SSF-GCGR cells transfected with GloSensor20F (Promega) were lifted and resuspended in imaging media (DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293 cells were co-transfected using Fugene 6 transfection reagent (Promega) with MAC-tag (600ng ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were rinsed and lysed with Passive Lysis Buffer (PBL, Promega), protein concentrations determined using the DC protein assay (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... retroviral plasmid was transfected to HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: HCT116 cells were transfected using JetPrime(Polyplus) and HEK293 using Fugene (Promega) using a standard protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmid DNAs were transfected into HEK293 cells with ViaFect Transfection Reagent (Promega) according to manufacturer’s instruction.
-
bioRxiv - Physiology 2023Quote: ... whereas HEK293 cells stably expressing a luminescent cAMP GloSensor (GS-293) (Promega) were previously created in our lab 25 ...
-
bioRxiv - Cancer Biology 2024Quote: ... were cloned into pcDNA3.1-myc-His plasmid (Promega). For sequencing we used a sequence analyser (ABI Prism 3100 Avant ...
-
bioRxiv - Microbiology 2023Quote: ... or the Magne-His purification system (Promega Corporation) for PlzARD-RD per manufacturer protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... HEK293 cells were transfected in the 24 well plates using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2019Quote: ... genomic DNA from puromycin selected cells and wild-type HEK293 cells was extracted (Promega Wizard Genomic DNA Purification Kit #A1120 ...
-
bioRxiv - Neuroscience 2022Quote: HEK293 cells (ATCC, Manassas, VA) stably expressing both D3R and GloSensor 22F-cAMP (Promega) were created for these experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293 cells were transfected with the VHL-NanoLuc fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293-µOR cells were transfected with a plasmid encoding pGloSensor-20F cAMP reporter (Promega). Cells were harvested 24 h post transfection and resuspended at a 1.5x10^6 live cells/ml in assay media (DMEM without phenol red or FluoroBrite DMEM ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were treated for 8 hours with either 0.1 µmoles/L Coumermycin A1 (Promega) or an equivalent volume of DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 was used for transfection of plasmids with FuGENE HD Transfection reagent (Promega, Tokyo, Japan). RIPA buffer was used for obtaining proteins from whole cells ...
-
bioRxiv - Immunology 2020Quote: ... expression constructs were transfected into the HEK293 EBNA cells using FuGENE HD transfection reagent (Promega). After selection with puromycin ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid constructs were acutely transfected into HEK293 cells using Viafect reagent (E4981; Promega, Madison, WI), following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 T cells were co-transfected with the target receptor construct and GloSensor cAMP reporter (Promega) in DMEM supplemented with 10% FBS for overnight incubation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified BAC and plasmid DNA were transfected into HEK293 cells with FuGene HD transfection reagent (Promega) in a 1:3 DNA:FuGene HD ratio ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were transfected with β1AR and a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...