Labshake search
Citations for Promega :
1 - 50 of 6407 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 2.25 ng/uL Single-Stranded DNA Binding Protein (Sigma, cat# S3917 OR Promega, cat# M301A). 12.5 uL of master mix was mixed with 12.5 uL of 2x input oligonucleotide ...
-
bioRxiv - Genomics 2023Quote: ... The single-stranded DNA generated using this method was purified using PCR purification kit (A9285; Promega) and quantified using Nanodrop ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 36 μL 1.0 M lithium acetate (LiAc) and 50 μL single-stranded carrier DNA (2.0 mg/mL) (herring sperm DNA, Promega) were added onto the cell pellet ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 36 μL 1.0 M lithium acetate (LiAc) and 50 μL single-stranded carrier DNA (2.0 mg/mL, herring sperm DNA, Promega), was added onto the cell pellet ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then reversely transcribed into single-stranded cDNAs by a Reverse-Transcription Kit (Promega, USA). In parallel experiments ...
-
bioRxiv - Neuroscience 2020Quote: Extracted DNA was quantified using Quantifluor double-stranded DNA kit (Promega Corporation, Australia) as per manufacturer instruction ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from single colonies using Wizard® Genomic DNA Purification Kit (Promega). The DNA extracts were shipped to the Wellcome Sanger Institute for sequencing on the Illumina HiSeq platform (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from single mosquitoes using the Wizard genomic DNA purification kit (Promega) and PCRs were performed as described above
-
bioRxiv - Microbiology 2023Quote: ... single transconjugant colonies were subjected to DNA extraction using Wizard Genomic DNA Purification Kit (Promega), and the DNA was used for PCR amplification using the PCRBIO HS Taq Mix Red polymerase ...
-
bioRxiv - Biochemistry 2019Quote: ... 1ul of 10nM synthetic single stranded RNA and 1ul RNAsin (Promega, Madison, WI). For rescue experiments with purified La ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Single cultures were used for DNA extraction using the Wizard® genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA was extracted from whole single adult mosquitoes using either the Wizard Genomic DNA Purification Kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted from a single colony of each isolate with a Wizard® Genomic DNA Purification Kit (Promega), and the quantity and quality were determined with a Quantus Fluorometer (Promega ...
-
bioRxiv - Bioengineering 2022Quote: ... The resulting double-stranded DNA fragments were purified using a PCR Clean-up Kit (Promega, Cat# A9282). The purified DNA was then cloned into the entry vectors in place of the respective SERF using Golden Gate techniques [14 ...
-
bioRxiv - Genetics 2024Quote: ... Single-stranded cDNA was prepared from the DNase-treated RNA using GoScript Reverse Transcriptase System (Promega).
-
bioRxiv - Bioengineering 2020Quote: ... double-stranded DNA was quantified using QuantiFluor dsDNA System (Promega). Glycosaminoglycan (GAG ...
-
bioRxiv - Microbiology 2021Quote: ... Five ml of BHI broth containing 10 μg/ml tetracycline was inoculated with a single colony and genomic DNA was extracted (Wizard DNA extraction kit, Promega). Genomic DNA was sequenced by paired-end joining Illumina (Biomics Platform of the Institut Pasteur ...
-
bioRxiv - Molecular Biology 2020Quote: Human Genomic DNA was extracted from the blood using the Wizard Genomic DNA Purification kit (Promega) as per the instructions.
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA (gDNA) was extracted from human frontal cortex using Wizard Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... One μg of RNA was reverse transcribed into single stranded cDNA (Go Script Reverse Transcription System, Promega) and subsequently used for qPCR analyses on a Step One Plus real time PCR detection system (Applied Biosystems) ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was prepared from single cell suspensions of thymic leukemias using the Wizard Genomic DNA Purification Kit (Promega, Madison WI). PCR amplification of the Jak3 pseudokinase domain was performed using MyTaq HS Red Master Mix (FroggaBio ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA quantifications were performed by QuantiFluor double-stranded DNA (dsDNA) system (Promega, Madison, WI, USA). PCR amplification was performed in a total reaction mixture of 10 μL containing 1x SensiFast master mix (Bioline ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Biochemistry 2022Quote: The single-stranded form of the phagemid pGEM-11Zf+ and the superspiral pGEM-11Zf+ (Promega, Madison, WI, USA) were used as cofactors in ATP hydrolysis activity assays.
-
bioRxiv - Neuroscience 2022Quote: ... for the synthesis of sense and antisense single-stranded RNAs (ssRNA) with T7 and T3 RNA polymerase (Promega), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... The binding proteins were eluted by trypsin (Promega Corporation, Madison, WI, USA) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... of RNA were reverse-transcribed into single-stranded complementary cDNA using an oligo-dT primer and M-MLV Reverse Transcriptase (Promega). The single-stranded cDNA products were amplified by PCR using gene-specific sense and antisense primers (mRNA TPK1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075) and Sp6 (P1085) transcription polymerases from Promega. Transcription was performed after manufacturer’s instructions except for the use of the DIG-labeling mixture (11277073910 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the T249A donor plasmid or T249E single-stranded oligo included the point mutation leading to amino acid change were transfected with PuroCas9-hTERT using FuGeneHD (Promega) into 293T cells ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells with the RAI13103insC mutation were generated by introducing the plasmid expressing Cas9 and sgRNA with single-stranded oligodeoxynucleotides (Supplementary Sequence 2) by FuGENE HD (Promega). The Cas9-expression plasmid with the sgRNA sequence for generating the RAI13103insC mutation and the GFP/puromycin expression plasmid (70 ng of each plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... and E2 DNA-binding sites) and to pSV40-luc (pGL3-Control from Promega, containing the SV40 promoter and enhancer regions but no E2 DNA-binding sites) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Genetics 2023Quote: High molecular weight DNA was isolated from spleen tissue of a single male from each of the 11 imported Nachman wild-derived inbred strains using the Wizard DNA Purification Kit (Promega) or the Monarch HMW DNA kit (NEB ...