Labshake search
Citations for Promega :
1 - 50 of 6312 citations for Human Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: T7 transcription reactions (MEGAscript T7 transcription kit-Promega) were assembled according to manufacturer’s recommendation with 1 μg of E7 plasmid DNA linearised with NotI or TK-Ren plasmid linearised with XbaI ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription Kit (Promega, USA); IBV nucleic acid amplification fluorescence detection kit (Shanghai Furex Medical Scientific and Technological Development Co. ...
-
bioRxiv - Microbiology 2020Quote: A random-primers based reverse transcription of 1 μg of RNA was performed with the A3500 Reverse Transcription System Kit (Promega), followed by quantitative real-time PCR on cDNA using the FastStart Essential DNA Green Master kit (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using the GoScript Reverse Transcription Kit (Promega A50001) per manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription was done using cDNA ImProm-II reverse transcription kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: The Reverse Transcription System Kit (Promega) was used to synthesize a cDNA library following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... GoScript Reverse Transcription Kit (Promega, #A5003) was used as per manufacturer instructions with the following modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Reverse transcription kit (Promega) was used to make cDNA following manufacturer indications ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega). Quantitative PCR was performed by using the Agilent Mx3000P qPCR system with the 2×SYBR Green qPCR Master Mix (Bimake) ...
-
bioRxiv - Microbiology 2020Quote: ... or GoScript™ Reverse Transcription kit (Promega) and stored at −20°C until analysis ...
-
bioRxiv - Immunology 2020Quote: ... and reverse transcription kit (A5000, Promega, USA), respectively ...
-
bioRxiv - Genetics 2023Quote: ... with the Reverse Transcription System kit (Promega) using random primers and adjusting the RNA volumes based on RNA concentrations.
-
bioRxiv - Molecular Biology 2023Quote: ... The ImProm-II reverse transcription kit (Promega) was used to synthesize cDNA from 1 µg of total RNA using the included oligo dT primers in a volume of 20 µL per the manufacturer’s direction ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed with a GoScript™ Reverse Transcription Kit (Promega, Shanghai, China). RT-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by reverse transcription (RT) using M-MLV reverse transcription kit (Promega, Madison, WI, USA). Blank qPCR Master Mix kit (EURx ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit, Promega). Quantitative RT-PCR was performed using FluoCycle II SYBR Master Mix (EuroClone ...
-
bioRxiv - Neuroscience 2021Quote: ... and used for reverse transcription (Promega RT kit) to generate cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... reversed by reverse transcription kit (Promega, United States). The sequence primers of SARS-CoV were synthesized by bio-engineering Co. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using the GoScript Revers Transcription System kit (Promega). RT was performed in an Eppendorf Mastercycler to synthetize cDNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... Retro-transcription to cDNA was performed with the ImProm-IITM Reverse Transcription System kit (Promega, A3800) following manufacturer’s instructions ...
-
Induction of osteogenic differentiation of MSCs by GSK3β knockdown through GSK3β siRNAs transfectionbioRxiv - Molecular Biology 2023Quote: ... Reverse transcription was performed using the ImProm-II™ Reverse Transcription System reagent kit (Promega, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA was synthesized using 1 µg total RNA with MMLV Reverse Transcription Kit (Promega) and poly-T primer ...
-
bioRxiv - Microbiology 2023Quote: ... Complimentary DNA was prepared from 1 µg of RNA using a Reverse Transcription Systems Kit (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human SMARCB1 was translated in vitro using TNT Quick Coupled Transcription/Translation System (L1170, Promega). 1 µg of pcDNA3.1-FLAG-SMARCB1 was incubated at 30°C for 90 minutes with 20 µM methionine and TNT T7 Quick Master Mix ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... The revers transcription (RT) reaction was performed by M-MLV reverse transcription kit (Promega, Madison, WI, USA).
-
bioRxiv - Microbiology 2020Quote: ... and the reverse transcription reaction was conducted using a Goscript™ Reverse Transcription System kit (Promega, Madison, WI). The RNA quality was confirmed by spectrophotometry and electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... RNAs were subsequently generated by in vitro transcription overnight at 37°C using RiboMAX transcription kits (Promega Corporation). After RQ1 DNAse digestion of the template cDNA ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 ug of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 µl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Bioengineering 2020Quote: ... This purified plasmid was used as a template for in vitro transcription with a Ribomax transcription kit (Promega) to generate RNA of ~1488nt ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μg of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 μl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was prepared using Reverse Transcription Systems Kit (Promega, WI) or rAmp
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... expressed using the TNT Quick Coupled Transcription/Translation Kit (Promega), diluted 1:1 in MEDMDG buffer (25 nM MOPS ...
-
bioRxiv - Biochemistry 2021Quote: ... the TNT® Quick Coupled Transcription/Translation Kit from Promega was used according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription was performed with the P1230 kit (Promega). 2ug of viral RNA was transfected into 1 × 106 cells HeLa cells using Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was generated with the GoScript Reverse Transcription kit (Promega) with 1μg RNA from each sample ...
-
bioRxiv - Biochemistry 2023Quote: The TNT® Quick Coupled Transcription/Translation Kit from Promega was for synthesis of 35S-methionine labeled proteins in reticulocyte lysate ...
-
bioRxiv - Microbiology 2023Quote: ... used for in vitro transcription with the RiboMAX kit (Promega) and the resulting RNA was purified using the NucleoSpin RNA mini kit (Machery-Nagel ...
-
bioRxiv - Pathology 2022Quote: ... A total of 1 µg of extracted RNA was transcribed into cDNA using GoScript Reverse Transcription Kit (Promega). Quantitative real-time PCR was performed using FastStart SYBR Green Master mix (Roche ...