Labshake search
Citations for Promega :
1 - 50 of 5817 citations for Human Metastasis Suppressor KiSS 1 KISS1 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was isolated from strains containing extragenic suppressor mutations using the Wizard Genomic DNA Purification Kit (Promega) and sent for whole genome sequencing (Tufts University School of Medicine Genomics Core).
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: Human Genomic DNA was extracted from the blood using the Wizard Genomic DNA Purification kit (Promega) as per the instructions.
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA (gDNA) was extracted from human frontal cortex using Wizard Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...