Labshake search
Citations for Promega :
1 - 50 of 4049 citations for Human Matrix Metalloproteinase 13 Collagenase 3 MMP13 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Immunology 2021Quote: ... Phorbol 12-myristate 13-acetate (Promega) and ionomycin (Tocris ...
-
bioRxiv - Genetics 2020Quote: A caspase - Glo 3/7 kit (Promega) was used to evaluate caspase 3/7 activity based on the kit protocol ...
-
bioRxiv - Microbiology 2024Quote: ... the Caspase-Glo-3/7 kit (Promega) was used as previously described (22) ...
-
bioRxiv - Cell Biology 2024Quote: ... Trypsin buffer containing 13 ng/mL trypsin (Promega) in 10 mM ammonium bicarbonate and 10% (v/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Caspase-3/7 activities were measured using Caspase-Glo 3/7 Assay kits (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... for Calu-3 cells and CellTiter-Glo 3-D Cell Viability Assay Kit (Promega, Germany) for hBAECs according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Caspase-3/7 activity was detected using the Caspase-Glo 3/7 Assay Kit (Promega) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 cleavage activity was measured by Caspase-Glo 3/7 Assay Kit (Promega). 1 ×104 cells/well were plated in a pre-coated 96-well plate ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Cancer Biology 2021Quote: Caspase-3/7 activity was detected using a luminometric assay kit (Caspase-Glo 3/7; Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 activity was assessed by the Caspase-Glo® 3/7 Assay kit (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activity was measured using the Caspase-Glo 3/7 Assay Kit (Promega G8091). Pre-treatment of cells with EGF ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activities were detected by Apo-ONE Homogeneous Caspase-3/7 Assay kit (Promega) according to the manufacturer’s protocols.
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: The activity of caspase 3/7 was measured using the Caspase-Glo 3/7 assay kit (Promega) following the instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-3 and -7 activities were measured using the Caspase-Glo 3/7 assay kit (Promega, G8090) according to manufacturer’s instructions ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Cell Biology 2019Quote: 832/13 cells stably expressing NPY-pHluorin were transfected (FuGene, Promega) with NPY-mCherry ...
-
bioRxiv - Cell Biology 2019Quote: 832/13 cells stably expressing NPY-pHluorin were transfected (FuGene, Promega) with NPY-mCherry ...
-
bioRxiv - Microbiology 2019Quote: The activation of caspases 3 and 7 was determined using the Caspase-Glo 3/7 assay kit (Promega), according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo 3/7 Assay Kit (Catalog No. G8091, Promega) for each sample according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Cancer Biology 2021Quote: The activity of caspase-3/7 was measured by Caspase-Glo-3/7 assay kit according to the manufacturer’s instructions (Promega). Cell death was assessed by an Annexin-V FITC binding assay (Miltenyi ...
-
bioRxiv - Biochemistry 2021Quote: Caspase-3/7 activity was quantified by fluorometric assay using ApoONE Homogeneous Caspase-3/7 Assay Kit (Promega, US). AU565 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Cancer Biology 2021Quote: Caspase 3/7 and 9 activities were assessed using a fluorescence-based Apo-ONE homogenous caspase 3/7 assay kit (Promega) and luminescence-based caspase-glo 9 assay system (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... grown for 48 h and then caspase 3/7 enzymatic activity determined using Apo-One Homogenous caspase 3/7 activity assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase3/7 activity was measured 3 days after the treatment with a commercial available kit (Caspase-Glo 3/7 Assay, Promega).
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity was measured using a luminescence Caspase Glo 3/7 assay kit (G8090; Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Caspase 3/7 enzymatic activity in raw cell lysates was measured using a Caspase Glo 3/7 assay kit (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... caspase-3/7 activities in cells were measured using a luminometric assay kit Caspase-Glo 3/7 (Promega, Madison, WI). The amount of luminescence was measured on the Victor3™ multilabel reader (PerkinElmer Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins bound to streptavidin-sepharose matrix were digested with trypsin (Promega, Madison, WI, USA) during 16 h or eluted for western blot analysis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5µg was analyzed using the Caspase 3/7 glo kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cellular apoptosis was analyzed with Caspase-Glo 3/7 assay kits (Promega), which measures Caspase-3/7 activity ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Promega Caspase-Glo™ 3/7 Assay Kit was obtained from Promega Corporation (Madison ...
-
bioRxiv - Physiology 2023Quote: ... and the Caspase-Glo 3/7 Assay Kit was purchased from Promega.
-
bioRxiv - Neuroscience 2024Quote: ... and the Caspase-Glo 3/7 assay kit (#G8090, Promega, Nacka, Sweden) were used in 96-well plates (Sarstedt #82.1581.001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...