Labshake search
Citations for Promega :
1 - 50 of 4121 citations for Human Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Biophysics 2020Quote: ... pHaloTag-H3 and-H4 were purchased from Promega (pFN21AE1298 and pFN21AE0273 ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Cell Biology 2021Quote: ... the Histone H3.3-HaloTag® Fusion Vector was purchased from Promega, while the sequences for NSD2 or NSD3 PWWP1 domain was cloned in-frame into a pNLF1-C [CMV/Hygro] vector from Promega using the In-Fusion HD Cloning kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histones were then digested with 1 μg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Biochemistry 2021Quote: ... Histones were then digested with 1 μg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Cell Biology 2022Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histones were digested in 50 mM ammonium bicarbonate using Arg-C (Promega), and the resulting peptides desalted by C18 StageTip 86 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Genomics 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Cell Biology 2024Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Developmental Biology 2019Quote: ... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
bioRxiv - Physiology 2022Quote: ... 0.5 ng of Trypsin Gold (for the proteolysis with H3-H4, catalog no. V528A, Promega) or 1 ng of Trypsin Gold (for the proteolysis with H2A-H2B ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cell Biology 2022Quote: ... Baseline fluorescence was measured in an ELISA reader (Promega) following an incubation of 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Molecular Biology 2020Quote: Human Genomic DNA was extracted from the blood using the Wizard Genomic DNA Purification kit (Promega) as per the instructions.
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA (gDNA) was extracted from human frontal cortex using Wizard Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Histones extracted from HeLa cells were dissolved in 50 mM NH4HCO3 buffer and digested with trypsin (Promega) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 hours after plating cells were transfected with 1μg of histone H3.3-HaloTag®Fusion Vector DNA (Promega) + 0.1 μg of NSD2 PWWP1-NanoLuc® Fusion Vector DNA (C-terminal ...
-
bioRxiv - Biophysics 2023Quote: ... ELISA plates were read on a GloMax plate reader (Promega, Wisconsin, US). Data were converted from concentration to total mass based on the volume of media/pellet ...
-
bioRxiv - Plant Biology 2021Quote: ... antibodies before probing with horseradish peroxidase (HRP)-conjugated anti-rabbit (for H3) or anti-mouse (for anti-GFP and anti-TUB) as the secondary antibody (1:5000; Promega, Madison ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... cDNA synthesis from 5 µg RNA was performed using the GoScriptTM Reverse Transcriptase Kit (Promega). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 5× Gotaq buffer (Promega M792A), 1μl of 10μM forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... 5 µL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... and plates were incubated for 5 days before being assayed using the Cell Titer-Glo kit (Promega).
-
bioRxiv - Immunology 2020Quote: ... Total IgG and ANA ELISA plates were read using a GlowMax Discover Microplate Reader (Promega) on the absorbance setting at 450nm.