Labshake search
Citations for Promega :
1 - 50 of 867 citations for Histatin 3 HTN3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: HEK293 cells growing at 70% confluency in a 10 cm dish were transfected with wild-type human NOPR or NOPLight (3 µg DNA) and GloSensor-20F (Promega, 2.5 µg DNA) using 12 µL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL RNasin (Promega) and 100 µL lysis buffer for a total volume of 300 µL for IP by rotation for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... treated with 3 mM dithiothreitol (DTT) (molecular grade, Cat. 3483-12-3, Promega), and incubated for 30 min at 37°C in 5% CO2 in serum-free RPMI media ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase-3 and -7 activity was measured by Caspase-Glo 3/7 Assay (Promega) according the manufacturer’s instructions using a BioTek Synergy H1 plate reader.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega) and caspase activity was normalized to cell number by performing the CellTiter-Glo Luminescent Cell Viability Assay on the duplicate plate.
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega), and caspase activity was normalized to cell number by performing the CellTiter Glo Luminescent Cell Viability Assay on the duplicate plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and -7 activities were measured by Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... Caspase-3/7 activities were measured using Caspase-Glo 3/7 Assay kits (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μg of purified RNA was incubated with 3 units of RQ1 DNase (Promega) at 37°C for 30 mins ...
-
bioRxiv - Bioengineering 2021Quote: Caspase 3/7 activity was measured using the Caspase-Glo 3/7 assay (Promega). Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... caspase 3 activity was measured using Caspase-Glo 3/7 assay (Promega, Alexandria, Australia). Quantification of viable cells was performed by staining with 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 Glo (Promega) was used to measure caspase 3/7 cleavage ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 units/mL RNasin (Promega). Depending on the experiments (see results) ...
-
bioRxiv - Microbiology 2020Quote: ... caspase-3/7 activity was quantified using the Caspase-Glo-3/7 assay system (Promega). Luminescence was quantified using plate reader Synergy H1 Hybrid Reader (BioTek).
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-3/7 activity was measured using Caspase-Glo 3/7 Assay Systems (G8091, Promega) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... caspase-3/7 activity was quantified using the Caspase-Glo-3/7 assay system (Promega). Luminescence was quantified using plate reader Synergy H1 Hybrid Reader (BioTek).
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Immunology 2021Quote: Caspase 3/7 activity was measured using Caspase-Glo® 3/7 Assay (Promega, G8090) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 activity was assessed using the Caspase-Glo 3/7 assay reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The intracellular caspase-3/7 activity was measured using Caspase-Glo 3/7 Assay (Promega). For this ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase 3/7 activity was measured by adding Caspase-Glo 3/7 Assay Reagent (Promega), incubating for 45 min at room temperature and measuring luminescence in an EnVision 2104 Multilabel plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2022Quote: ... for Calu-3 cells and CellTiter-Glo 3-D Cell Viability Assay Kit (Promega, Germany) for hBAECs according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 cleavage activity was measured by Caspase-Glo 3/7 Assay Kit (Promega). 1 ×104 cells/well were plated in a pre-coated 96-well plate ...