Labshake search
Citations for Promega :
1 - 50 of 638 citations for Dl Pcb Rh12 Extended Calibration Solution Cs0.4H Unlabeled 13C12 99% In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... an extended time-released substrate (Promega), and plates were incubated at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... unlabeled PCR was cloned into pGEM-T Easy (Promega) and positive clones were checked by amplification with the vector-based primers M13f and M13R.
-
bioRxiv - Molecular Biology 2020Quote: ... Extended NanoLuc luciferase substrate Vivazine™ (Promega, #N2580) was added to live cells (dilution to 1X in serum-free DMEM ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Bioengineering 2021Quote: ... The standard calibration curve was made using lambda DNA (Promega, D1501).
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 1:20 of the extended live cell substrate EndurazineTM (Promega) was added to each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... Unlabeled proteins were cell-free-synthesized using the TNT T7 Quick Reaction system according to the manufacturer instructions (Promega) and incubated with purified GST fusion proteins coupled with glutathione sepharose 4B fast flow beads (GE healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The calibration curves were generated using serial dilutions of pGEM-T Easy plasmid DNA (Promega, USA) carrying a single copy of the target gene fragment (qp1F/qp1R) ...
-
bioRxiv - Plant Biology 2019Quote: ... using primers extended with BamHI and SacI restriction sites (GGATCCATGGA-TCATGATGCAATTA, and GAGCTCTCATGAACAACAAGG AGCC) and was subcloned into pGemT-easy (Promega). The subcloned amplicon was digested with BamHI and SacI and ligated to the BamHI-SacI digested expression vector pET24a(+)(Novagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The indicated DNA oligonucleotide and oligonucleotide ‘HDVrt’ were mutually extended upon one another using three thermocycles with GoTaq Hot-start DNA polymerase (Promega). This generated a double-stranded DNA comprising the DNA sequence of the desired RNA oligonucleotide ...
-
bioRxiv - Plant Biology 2022Quote: ... the coding sequence of RE02 extended by BsaI cleavage sites (Supplementary Table 3) was cloned into the pGEM®-T vector (Promega). The cauliflower mosaic virus 35 promoter ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Immunology 2024Quote: ... qPCR targeting the β-globin gene was performed for each sample and evaluated alongside a β-globin calibration curve (human gDNA, cat# G1521, Promega).
-
bioRxiv - Microbiology 2021Quote: ... Standard calibration was performed from a 10-fold serial dilution (103 to 108 molecules) of standard pGEM-T Easy plasmids (Promega, Madison, WI, United States) containing target sequences from Escherichia coli K12 ...
-
bioRxiv - Immunology 2024Quote: ... BrightGlo solution (Promega) was then added to the wells and luminescence was read on a SpectraMax plate reader (Molecular Devices ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20μL of MTS solution (CellTiter 96® Aqueous One Solution Reagent, Promega) was added to each well and plates were incubated for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... 20 μL of MTS solution (CellTiter 96 Aqueous One solution reagent, Promega) was added to each well ...
-
Building a robust chromatin immunoprecipitation (ChIP) method with substantially improved efficiencybioRxiv - Plant Biology 2020Quote: ... RNase A solution (Promega).
-
bioRxiv - Microbiology 2022Quote: ... Protein Precipitation Solution (Promega) was added to the lysate ...
-
bioRxiv - Genetics 2023Quote: ... Protein Precipitation Solution (Promega) was added to the lysed mixture ...
-
bioRxiv - Microbiology 2023Quote: ... Protein precipitation solution (Promega) was added and samples were vigorously mixed ...
-
bioRxiv - Bioengineering 2020Quote: ... Lungs were then placed into a solution of Nano-Glo substrate solution (Promega) diluted 50-fold in PBS ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... 20 μL of MTS solution (CellTiter 96® Aqueous One solution reagent, Promega) was added to each well ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl MgCl2 solution (Promega), 5 μl of PCR DIG labelling mix (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... digested with trypsin solution (Promega), and peptide fingerprinting was performed with a MALDI-TOF MS mass spectrometer (AB SCIEX 5800 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Trypsin/Lys-C solution (Promega) was added and incubated at 37°C for 12 h ...
-
bioRxiv - Biochemistry 2022Quote: ... the binding solution contains 1.0 µl of NanoLuc substrate stock solution (Promega, Madison, WI, USA). After addition to one well ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microliters of CellTiter 96® AQueous One Solution Cell Proliferation Assay solution (MTS, Promega G3580) prepared in DMEM + 5% FBS was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... 75 μL Nluc substrate solution (Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: ... ECL solution was from Promega (W1001).
-
bioRxiv - Cancer Biology 2019Quote: ... using a commercial luciferin solution (Promega) as a substrate ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5% SDS (Promega 10% SDS solution), 0.2 M NaCl ...
-
bioRxiv - Immunology 2019Quote: ... Stop solution (Promega Corporation UK Ltd) was added to halt the reaction and results acquired using a spectrophotometer (VersaMax ...
-
bioRxiv - Cancer Biology 2019Quote: ... Kinase detection solution (10 μL) (Promega) was added and incubated for 15 minutes at room temperature and luminescence was measured on a plate reader.
-
bioRxiv - Physiology 2023Quote: ... Trypsin solution (25µg/mL, Promega France), 20 mM ammonium bicarbonate and 0.01 % glycerol (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: CellTiter-Glo 2.0 solution (Promega G9248) was used to measure the extracellular ATP released from spheroids ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 µL BrightGlo reagent solution (Promega) diluted 1:3 in water was added to each well and then ARE-LUC luminescence values were recorded on an Envision instrument (PerkinElmer).
-
bioRxiv - Genomics 2024Quote: ... Celltiter-Glo solution (Promega, ref. G7573) was added to cells grown in 96-well plates ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then incubated with CellTiter 96 Aqueous One Solution Proliferation Solution for 1 hour (Promega, Fitchburg, WI). Absorbance of the solution was then read at 490 nm ...
-
bioRxiv - Developmental Biology 2019Quote: The PCR mix was generated by adding 2µl of the lysed solution to a solution containing 1.25µl GoTaq™Flexy polymerase (Promega), 0.31 mM dNTPs (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was incubated with trypsin (Promega) in a 1:50 (w/w ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of GreenLys solution (FluoroTect, Promega) was supplemented to a PUREfrex2.0 mix (total volume 10 µL ...
-
bioRxiv - Biochemistry 2020Quote: ... 15 μl Dye solution (Promega cat. #G4102) was added into each well ...
-
bioRxiv - Microbiology 2022Quote: ... then resuspended in Nuclei Lysis solution (Promega) supplemented with 0.05% SDS ...
-
bioRxiv - Biochemistry 2022Quote: ... ECL solution from Promega (Cat. no. W1015) was used as a substrate for the HRP ...
-
bioRxiv - Microbiology 2021Quote: ... incubated with luciferase substrate solution (Promega E1500), and luciferase activity was quantified with the BioTek Synergy HTX microplate reader.
-
bioRxiv - Immunology 2022Quote: ... The solution was incubated with trypsin (Promega) in a 1:50 (w/w ...
-
bioRxiv - Physiology 2022Quote: CellTiter 96 AQueous One Solution Reagent (Promega) was used to assess the effect of EVs on cell proliferation rate in in vitro autotransplantation approach (n=4) ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 μL of trypsin digestion solution (Promega, 5 μl of reconstituted trypsin were dissolved in 100 μL 50 mM Tris-HCl buffer pH 8 ...