Labshake search
Citations for Promega :
351 - 400 of 2032 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2022Quote: ... In-vitro translations were done with rabbit reticulocyte lysate (Flexi Rabbit Reticulocyte Lysate System, Promega) and translated CFTR (domains ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To determine Caspase 3/7 activity in THP-1 SAMHD1 KO and CTRL cells the Caspase-Glo 3/7 assay (Promega, Walldorf, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Cancer Biology 2019Quote: ... named Caspase-Glo® 3/7 assay (G8091, Promega). The assay was performed following the manufacturer’s protocol in white polystyrene 96-well plates (Nunc ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 Assay System (Promega, Cat. G8091) was used to measure the activity of caspase-3 and caspase-7 ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: The Caspase-Glo® 3/7 Assay System (Promega), a luminescence-based assay for detection of active caspase-3 and 7 ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Caspase-Glo 3/7 Assay System (Promega, cat # G8091) was used to quantify activated cellular caspase 3/7 per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptosis was measured using Caspase-Glo 3/7 (Promega). Early apoptosis and late apoptosis/necrosis were measured using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-m6A conjugated beads were incubated with purified mRNA with rotation at 4°C overnight in 300 µL MeRIP buffer with 1 µL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The recombinant plasmids were prepared from some positive clones using the PureYield Plasmid Miniprep System (Cat #A1222, Promega, Madison, USA). The sequencing of the cloned insert was carried out according to Sanger et al ...
-
bioRxiv - Biochemistry 2019Quote: The 5’UTRs of each transcript variant were transcribed and purified in vitro as previously described46 from linearized recombinant psiCHECK2 vector (Promega) that contained one of the three UTR sequences downstream of a T7 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were dissolved in 50 μL of 50mM TEAB and treated with 1 μL of recombinant PNGaseF (Promega, Madison, WI) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: RNA was isolated from pooled neurons that were stored at −80 in saline solution with 1% (v/v) Recombinant RNasin Ribonuclease Inhibitor (Promega). The RNA was extracted with the Quick-RNA micro prep kit (Zymo ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... The N-glycans were then released using 10 U recombinant Elizabethkingia miricola N-glycosidase F (Promega, V4831, 10 U/μL) for 16 h at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: CHO K-1 cells overexpressing hPD-L1 and the recombinant TCR ligand (hPD-L1 Antigen Presenting Cells, hPD-L1 aAPCs, Promega) and Jurkat T cells overexpressing hPD-1 and carrying a luciferase reporter gene under the control of Nuclear Factor of Activated T-cells Response Element (NFAT-RE ...
-
bioRxiv - Immunology 2020Quote: ... anti-m6 A conjugated beads were incubated with purified mRNA with rotation at 4C overnight in 300 mL MeRIP buffer with 1 mL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...