Labshake search
Citations for Promega :
2401 - 2450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quantification of cellular cholesterol was done using the Cholesterol/Cholesterol Ester-Glo™ kit (Promega, J3190), according to the manufacturer’s protocol miniaturized to a 384-well plate format ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were harvested 48 h after transfection and luciferase activity was measured using the Dual-Glo Luciferase Assay system (Promega) on a FlexStation® 3 plate reader ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Neuroscience 2024Quote: ... The antisense radio-labeled 35S-Vglut2 riboprobe was generated by in vitro transcription using a T7 RNA polymerase (Promega). 35S-labeled riboprobe was diluted in hybridization solution (50% formamide ...
-
bioRxiv - Cancer Biology 2024Quote: CellTiter-Glo® 3D Cell Viability Assay (Promega) was performed on Patient-Derived Organoids (PDOs ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2 µg of Trypsin/Lys C (V5071, Promega) was added into each 1001µl sample in 501mM ammonium bicarbonate overnight at 371°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The supernatant was discarded and pelleted nuclei were resuspended in 3 ml blocking buffer (1xPBS [Sigma-Aldrich, P4417-50TAB, US], 1% BSA [Sigma-Aldrich, A2153-10G, US], 0.2 U/µl RNAsin Plus RNase inhibitor [Promega, N2615, US]).
-
bioRxiv - Neuroscience 2024Quote: ... beads were resuspended in 100 μl of 25mM ABC buffer and digested by adding 0.20 μg of trypsine/LysC (Promega) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Positive colonies were screened by PCR using GoTaq G2 Hot Start green Master Mix (#M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
bioRxiv - Neuroscience 2024Quote: ... Frozen brain tissue was homogenised in a dounce-homogeniser containing 2 ml ice-cold lysis solution (Nuclei EZ Lysis Buffer [Sigma-Aldrich, NUC101] or Nuclei PURE Lysis buffer [Sigma-Aldrich, NUC201] with 1 mM dithiothreitol [DTT, Promega, P1171 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins bound to magnetic beads were washed twice with 100 µL of 25 mM NH4HCO3 and on-beads digested with 200 ng of trypsine/LysC (Promega) for 1 hour in 100 µL of 25 mM NH4HCO3 at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands <2kb were cloned using the pGEM-T Easy kit (Promega) and bands >2kb were cloned using the Topo-XL2 PCR kit (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... At the indicated time points cellular ATP was measured using CellTiter-Glo® (Promega) and luminescence detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments) ...
-
bioRxiv - Physiology 2024Quote: Cell proliferation was measured by CellTiter 96® Non-Radioactive Cell Proliferation Assay kit (MTT; Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luciferase assays wered performed using the Luciferase System Kit (Promega) and luminescence was measured ...
-
bioRxiv - Cell Biology 2024Quote: ... and cut finely prior to in-gel digestion with Trypsin/Lys-C Mix (Promega) at 37 °C for 12 h ...
-
bioRxiv - Microbiology 2024Quote: LDH in BMDM supernatants was quantified using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega®) following the manufacturer’s instructions.
-
Pushed to the edge: hundreds of myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2024Quote: ... The construct includes an N-terminal Halotag (Promega; GenBank: JF920304.1), the full-length human Myo10 sequence (nucleotide sequence from GenBank ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfection of the different plasmids was made in a ratio 4:1:4 using lentiviral components pCMVR8,74 (Gag-Pol-Hiv1) and pMDG2 (VSV-G) vectors and the plasmid of interest respectively using FuGENE HD (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Dilution with Tris 50mM was done before the addition of trypsin 500 ng (Promega) and digestion at 37°C for 8h ...
-
bioRxiv - Molecular Biology 2024Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Microbiology 2024Quote: ... we confirmed that each primer set amplified single bands in a ligation-dependent manner by GoTaq Hot Start Green Master Mix (Promega, Madison, WI) (Figure S10) ...
-
bioRxiv - Molecular Biology 2024Quote: ... First strand cDNA was synthesized using GoScript Reverse Transcriptase (Promega) with 18-mer oligo(dT ...
-
bioRxiv - Molecular Biology 2024Quote: ... GoTaq polymerase (Promega) was used for all the RT-PCR reactions using gene-specific primers (Table S1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Isolated RNA samples were DNAse (Promega,) treated ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nanoluc fusion inserts (Promega, NV2341/NV2381) were subcloned into a PLV-CMV-IRES vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... Immediately after intracellular TE Nano-Glo Substrate/Inhibitor (Promega, N2160) addition ...
-
bioRxiv - Molecular Biology 2024Quote: ... the dedicated tracer (Promega) and the test compounds were incubated to the cells at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were lysed with passive lysis buffer and Dual luciferase assay kit (Promega) was used to assess luciferase activity using luminometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The solution was diluted four times and digested with Trypsin at 1:50 (w/w; Promega).
-
bioRxiv - Cancer Biology 2024Quote: The Luciferase reporter vector were constructed via insertion of uc.110 conserved region and 3’UTR of MFRP downstream of Renilla luciferase stop codon in psi-CHECK2 dual luciferase vectors (Promega, Madison, WI, USA). The insertions were validated by sequencing ...
-
Pushed to the edge: hundreds of myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2024Quote: HaloTag standard protein (Promega, G4491) samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... The isolated RNA was treated with 10 units of DNase I (Promega), extracted with acidic phenol-chloroform ...
-
bioRxiv - Molecular Biology 2024Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated using the ReliaPrep RNA Miniprep Systems (Promega) and sequenced using the Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT-PCR reactions were performed using synthesized cDNAs as template and gene-specific primers (Table S1) to quantify the relative mRNA levels of Tc_WapF with GoTaq® qPCR Master Mix (Promega) according to the manufacturer’s instructions.Three independent biological replicates were used for each quantitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified amplicons were used as template in in-vitro transcription reaction using T7 RiboMAX™ Express RNAi System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were then diluted with 25 mM ABC and digested with sequencing-grade modified porcine trypsin (Promega) at 37 °C for 16 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR reactions were performed using the GoTaq 1-Step RT-qPCR System (Promega GmbH, Walldorf, Germany). 100 ng of isolated mRNA were used per reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... The absorbance of each well at 450 nm was measured using a Promega GloMax luminescence detector (Promega, Madison, WI, USA).
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was determined using CellTiter-Glo® reagent (Promega, # G7570) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... The viability of cells was measured using CellTiter-Glo” Luminescent assay (Cat #: G7570, Promega) after 72 hours of drug treatment ...
-
bioRxiv - Cancer Biology 2024Quote: ... Short tandem repeat-based authentication of cell lines was performed at the Genomics and Transcriptomics Laboratory (GTL, Heinrich Heine University Düsseldorf, Germany) using the GenePrint 10 system (Promega, #B9510).
-
bioRxiv - Biophysics 2024Quote: The MTS colorimetric test (Promega, Poland) was used to determine the influence of lectin-coated substrates on the proliferation of bladder cancer cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... We used Proteasome-Glo™ Chymotrypsin-like Assay (Promega G8621) and calculated the proteasome enzymatic activity in accordance with manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... MTS reagent (CellTiter96; Promega, Madison, WI) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was assessed using CellTiter-Glo 2.0 (Promega, G9241) per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7571) was added (50% v/v ...