Labshake search
Citations for Promega :
651 - 700 of 988 citations for Mouse Anti Human IgG Fab Alexa Fluor 568 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... human CaV1.3 cDNA (accession number NM_001128840.2) was de-novo synthesized and assembled into a HaloTag vector (Promega G7721) using restriction cloning ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ARC (SantaCruz Biotechnology, #sc-17839, anti-HaloTag (Promega, #G9211), anti-SNAP-tag (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... infected target cells were washed with DPBS and the medium was replaced with 50 μl of RPMI 1640 with 4% low IgG serum (Promega # G711A) containing 5 x 104 Jurkat effector cells (Promega # G701A ...
-
bioRxiv - Microbiology 2023Quote: ... infected target cells were washed with DPBS and the medium was replaced with 40 μl of RPMI 1640 with 4% low IgG serum (Promega # G711A) containing 5 x 104 Jurkat effector cells (Promega # G701A ...
-
Caspase-8 Modulates Angiogenesis By Regulating A Cell Death Independent Pathway In Endothelial CellsbioRxiv - Developmental Biology 2019Quote: The Caspase-8 Glo® assay was performed in combination with the CellTiter-Fluor™ Cell Viability Assay (both from Promega) according to the manual ...
-
bioRxiv - Cell Biology 2021Quote: ... conditions with HaloTag fusion protein expression were also incubated with 100nM of Janelia Fluor® 646 HaloTag® Ligand (Promega GA11220) for 30min prior to fixation ...
-
bioRxiv - Cell Biology 2019Quote: ... non-fluorescent blocking ligand was washed out and cells were additionally washed three times with fresh DMEM medium and incubated DMEM medium containing Janelia Fluor 646 (JF646) HaloTag ligand (Promega, GA1121) in final labeling concentration 200 nM for indicated timepoints.
-
bioRxiv - Cancer Biology 2021Quote: ... The viability of the cultures was determined 24 h and 48 h after EV treatments by using the CellTiter-Fluor cell viability assay kit from Promega (G6080) following manufacturers instructions ...
-
bioRxiv - Cell Biology 2022Quote: For STED imaging proteins of interest were genetically fused to the HaloTag (Halo) and subsequently labelled with Janelia Fluor®646 HaloTag ligand (#GA1121, Promega) by incubating 200 nM ligand (from 200 μM stock in DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... A volume of cells equivalent to 1 mL at OD600 = 0.2 was centrifuged and re-suspended in 1ml fresh medium supplemented with JF549 (Janelia Fluor®HaloTag®Ligands, Promega) at a final concentration of 1 µM ...
-
bioRxiv - Biophysics 2023Quote: ... each respective cell type was incubated at 37 °C with 500 pM of Janelia Fluor® 646 HaloTag Ligand (NSCs, ECs, or keratinocytes) (Cat. No. GA1120, Promega) or Janelia Fluor® 635 HaloTag Ligand (MNRs ...
-
bioRxiv - Cell Biology 2023Quote: Cells grown under confluency were incubated in CM+bFGF media containing 1μM cell permeable Janelia Fluor® 549 HaloTag ligand complex (Promega, GA1110) for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were cultured at 37C 5% CO2 with 2i + LIF medium containing 200nM of Janelia Fluor 549 HaloTag ligand (Promega GA1110). After 30 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... they were transfected with either control plasmid or Flag-GSK-3α WT human plasmid using Fugene 6 (Promega, #E2693) at a 3:1 ratio (DNA:Fugene 6) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used are mouse β-Gal (1:250; Promega #Z3781), mouse anti-Wingless (1:100 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or HA-mouse μOR and pGloSensor22F-cAMP plasmids (Promega, Madison, WI, USA) using Xtremegene9 (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from mouse tail using genomic DNA extraction kit (Promega Wizard SV Genomic DNA Purification System ...
-
bioRxiv - Molecular Biology 2022Quote: ... Both mouse brain and cell lysates were digested with DNase I (Promega) for 5 minutes at 37°C and then with RNase A (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat immunoglobulins against rabbit or mouse immunoglobulins conjugated with horseradish peroxidase (Promega) were used as secondary antibodies ...
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were cultured in 96 well plates and metabolic activity was measured using Cell-Titer-Glo assay or CellTiter-Fluor™ Cell Viability Assay (Promega, USA), as per manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: HeLa cells expressing each Halo-tagged chromatin remodeler were labeled with 5 nM Janelia Fluor® 549 (JF549) Halo-tag® ligand (GA1110, Promega) for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... mEPCs were incubated with 100 nM SiR-tubulin (Spirochrome, SC002) for 30 min or 200 nM Janelia Fluor® 549 HaloTag ligand (Promega, GA1110) for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated for 30 minutes with Janelia Fluor 635 HaloTag ligand (a final concentration of 20 nM, Promega, Madison, WI, USA) 24 hours before imaging to visualize the transiently expressed CENP-A-HaloTag.
-
bioRxiv - Microbiology 2024Quote: ... bradyzoites were incubated with phenol red free alkaline-stress medium containing 200 nM Janelia Fluor® HaloTag® 646 ligand (Promega, GA1120) for 15 min to label HaloTag-FYVE ...
-
bioRxiv - Biochemistry 2020Quote: The two Munc13-Halo proteins were labeled by incubating the protein with Alexa 488 conjugated with HaloTag® from Promega, as described before (2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...