Labshake search
Citations for Eton Bioscience :
1 - 41 of 41 citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... All qRT-PCR primers were ordered from Eton Bioscience. Quantitative real-time PCR was performed using the SYBR Green Mix (Cat# A25742 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were then sequenced using a T7 primer by Eton Bioscience, Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The presence of the correct constructs in plaque-purified transformed bacteria was confirmed by PCR (using primers p2TK2-SW2_seqF and p2TK2-SW2_seqR, Table S2) and sequencing of resulting PCR products (Eton Bioscience).
-
bioRxiv - Cell Biology 2021Quote: ... Primers were ordered from Eton Bioscience Inc ...
-
bioRxiv - Systems Biology 2021Quote: ... Primers were ordered from Eton Bioscience Inc ...
-
bioRxiv - Microbiology 2019Quote: ... All primers were synthesized by Eton Biosciences and purified using a standard desalting method.
-
bioRxiv - Neuroscience 2021Quote: ... forward and reverse primers (Eton Biosciences Inc., NC) and cDNA template ...
-
bioRxiv - Neuroscience 2022Quote: ... forward and reverse primers (Eton Biosciences Inc., NC) and cDNA template ...
-
bioRxiv - Microbiology 2022Quote: ... and primers (Table S3) generated by Eton Bioscience Inc (NC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcript-specific primers were purchased from Eton Biosciences, Inc.
-
bioRxiv - Neuroscience 2021Quote: ... forward and reverse primers (Eton Biosciences Inc., NC, USA), and cDNA template ...
-
bioRxiv - Neuroscience 2020Quote: ... forward and reverse primers (Eton Biosciences Inc., NC, USA), and cDNA template ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mutagenesis primers were obtained from Eton Bioscience:
-
bioRxiv - Neuroscience 2020Quote: ... forward and reverse primers (Eton Biosciences Inc., NC, USA), and cDNA template ...
-
bioRxiv - Cancer Biology 2021Quote: ... gene-specific primers (Table S1) (Eton Bioscience, San Diego, CA) and a BioRad CFX384 Touch™ Real-Time PCR Detection System.
-
bioRxiv - Microbiology 2020Quote: ... and sequenced using the forward and reverse primer by Eton Bioscience Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... All siRNAs and primers were purchased from Eton Biosciences (San Diego, CA). Inducible Lentiviral shRNA constructs targeting CstF64 were purchased from GE Healthcare Dharmacon ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were tested by PCR and all PCR products were sequenced by Eton Bioscience, San Diego ...
-
bioRxiv - Synthetic Biology 2019Quote: Toehold strands were created by ‘filling in’ ssDNA templates (IDT) with primer TCTGCTCTGCACTCGTAATAC (Eton Bioscience) at a ratio of 1:40 using 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... we selected the highest scoring sgRNAs calculated by CRISPOR and ordered primers from Eton Bioscience, Inc ...
-
bioRxiv - Immunology 2023Quote: ... Colonies were validated by Sanger sequencing using pLK0.1/hU6 promoter primer (Eton Biosciences, San Diego, CA). Lentivirus with sgRNAs were produced and used to transduce RAW MΦs stably expressing FL-Cas9 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid DNA was extracted and sequenced with M13 forward or reverse primers (Eton Bioscience Inc, San Diego, CA). DNA methylation analysis was performed using the Quantification tool for Methylation Analysis (QUMA ...
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
bioRxiv - Microbiology 2020Quote: ... sgRNA plasmids were validated by Sanger sequencing using the universal pLKO.1/hU6 promoter primer (Eton Biosciences, San Diego, CA). Lentivirus with sgRNAs were produced and used to transduce low passage FL-Cas9 RAW 264.7 cells ...
-
bioRxiv - Genetics 2023Quote: ... PCR amplicons were directly sequenced by Eton Bioscience (Durham, NC). A pairwise sequence alignment was performed to compare the genomic regions of Fo-w and Fo-cn obtained from the knockout lines to that of wildtype ...
-
bioRxiv - Genetics 2023Quote: ... The shortest PCR product was Sanger sequenced by Eton Biosciences .
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were confirmed by PCR and Sanger sequencing by Eton Bioscience Inc (NC ...
-
bioRxiv - Microbiology 2020Quote: ... The mutation was verified using PCR and Sanger sequencing (Eton Biosciences Inc.).
-
bioRxiv - Microbiology 2022Quote: ... Table S2) and by sequencing of the resulting PCR products (Eton Bioscience).
-
bioRxiv - Microbiology 2022Quote: ... and mutations were confirmed by PCR and Sanger sequencing conducted by Eton Bioscience Inc (NC ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/) and trimmed for quality prior to analysis.
-
bioRxiv - Microbiology 2020Quote: ... Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/) and trimmed for quality before analysis.
-
bioRxiv - Microbiology 2023Quote: ... We verified cloned inserts by colony PCR and Sanger sequencing (Eton Bioscience, NC). We introduced the deletion construct into PAO1 wt by electroporation and strains carrying single crossover insertions of the deletion constructs were selected on LB agar plates supplemented with 300 μg/mL chloramphenicol (77 ...
-
bioRxiv - Genomics 2019Quote: ... Sanger sequencing of PCR products was performed under contract by Eton Bioscience (Boston, MA), and trace data visualized using SnapGene Viewer software (v3.0.2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and mutations were confirmed by PCR and DNA sequencing (Eton Bioscience Inc, NC, USA).
-
bioRxiv - Microbiology 2020Quote: ... Final strain genotypes were verified using site-specific PCR and Sanger sequencing by Eton Biosciences, Inc (San Diego ...
-
bioRxiv - Cell Biology 2021Quote: ... and the R2830H site was screened by PCR for the presence of a TaqI site in the corrected locus and verified by Sanger sequencing (Eton Biosciences). Sanger sequencing data was deconvoluted using the ICE Analysis Tool (Synthego) ...
-
bioRxiv - Microbiology 2022Quote: ... and introduction of the mutant faaA allele in the chromosome of a kanamycin-sensitive isolate was confirmed by PCR and DNA sequencing (Eton Bioscience). The resulting strain was designated JMB66.
-
bioRxiv - Microbiology 2022Quote: ... and introduction of the flaG-2313 allele in the chromosome of a kanamycin-sensitive isolate was confirmed by PCR and DNA sequencing (Eton Bioscience). The resulting strain was designated JMB73.
-
bioRxiv - Microbiology 2022Quote: ... and the deletion of flgV in a kanamycin-sensitive isolate was confirmed by PCR and DNA sequencing (Eton Bioscience, Research Triangle Park, NC, USA) of the resulting amplicon ...