Labshake search
Citations for Roche :
1 - 50 of 3664 citations for rno mir 206 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... RT-PCR reactions were set up using the FastStart Essential DNA Green Master kit (Roche), using four different primer pairs ...
-
bioRxiv - Plant Biology 2022Quote: ... Primer sets were designed using ProbeFinder (Roche) and Primer 3 softwares and can be seen as Supporting Information (Table S1) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... We performed colony PCR using the primer set p898/p415 with KAPA2G Robust HotStart ReadyMix (Kapa Biosystems) to amplify transposon-pTarget junctions ...
-
bioRxiv - Immunology 2021Quote: ... in combination with the N-gene (inhouse primer sets in multiplex PCR) on LightCycler® 480 (Roche Diagnostics).
-
bioRxiv - Synthetic Biology 2019Quote: ... we performed colony PCR on transformants using the primer set p433/p415 with KAPA2G Robust HotStart ReadyMix (Kapa Biosystems) to amplify junctions between the Himar1 transposon from pHimar6 and the pGT-B1 target plasmid ...
-
bioRxiv - Biophysics 2022Quote: ... and a pUC19 template were set up: PCR-Dig with oGC101/oGC102 primers and 25 µM digoxigenin-11-dUTP (Roche), and PCR-Bio with oGC101/oGC103 primers and 25 µM biotin-16-dUTP (Enzo) ...
-
bioRxiv - Physiology 2019Quote: Quantitative real time PCR (qPCR) was performed with primer sets (Supplemental Table 1) designed using Roche Universal Probe Library Assay Design Center (Roche Diagnostics, UK) in conjunction with corresponding FAM-labelled probes ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length Treacle was amplified by PCR from cDNA with primer set #4 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BglII and BamHI sites respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length Treacle was amplified by PCR from cDNA with primer set #1 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained XhoI sites ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was used as template for RT-PCR with an adapter-specific primer (BRevOligo) and 10 units of Transcriptor Reverse Transcriptase (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using primers described in table S2 and KAPA SYBR Fast qPCR Master Mix (KAPA Biosystems) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extracts were tested by RT-PCR using the Titan One Tube RT-PCR kit (Roche) and the primers of Li et al. ...
-
bioRxiv - Immunology 2022Quote: ... and SYBR RT-PCR kit (Roche) were used for qRT-PCR analysis by using gene-specific primers (S1 Table) ...
-
bioRxiv - Biochemistry 2021Quote: ... the amino acid Thr at position 206 was mutated to Trp using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, USA) together with the designed complementary primers (5’- CCTATCTGATTCATGAGCACATGGTTATTTGGGATCGCATTGAAAAC-3’ and 5’- GTTTTCAATGCGATCCCAAATAACCATGTGCTCATGAATCAGATAGG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was performed using first strand synthesis with specific primers (Reagents) and SYBR FAST qPCR Kit (Kapa Biosystems, Wilmington, MA) in a StepOne cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was achieved using 2X Faststart PCR mastermix (Roche) using primer sets and cycling conditions described in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative (q)RT-PCR reactions for target genes were prepared using specific primer (Oligomer, Helsinki, Finland) and probe (Universal probe library, Roche, Basel, Switzerland) combinations (Supplemental Table S1) ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed using SybrGreen (Roche) on a Roch480II Lightcycler using the following primers ...
-
bioRxiv - Genetics 2020Quote: ... with SYBR Green RT-PCR (Roche, #4913914001). Melting curve analysis was performed for each primer set to ensure the specificity of the amplified product and with an efficiency of 2 ...
-
bioRxiv - Physiology 2022Quote: ... RT-PCR assays using the Lightcycler (Roche) with Roche universal probes and primer pairs are specified (Supplementary Table S1) ...
-
bioRxiv - Immunology 2023Quote: ... Titan One Step RT-PCR kit (Roche Diagnostics) was used to check the actual infection status of dengue virus using the primers targeting the capsid pre-membrane membrane region (Lanciotti et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... Another probe/primer set recognizing the ampicillin resistance gene relied upon the UPL probe #58 (Roche), the forward primer ...
-
bioRxiv - Neuroscience 2023Quote: ... and two sets of primers for WPRE or hGHpA genes using LightCycler 480 (Roche, Basel, Switzerland). The final titration of the AAV was estimated as relative quantitation according to a calibration curve calculated from the known numbers of copies of AAV plasmids.
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Microbiology 2024Quote: Quantitative RT-PCR (RT-qPCR) was performed using SYBR green master mix (Roche, Indianapolis, IN) and a Light Cycler 480 Instrument II (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative RT-PCR (Q-PCR) was performed using a LightCycler 480 II (Roche) and LightCycler DNA Master SYBR Green I detection (Roche ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR samples were analyzed using qPCR with SYBR green PCR mastermix (Roche), SYBR Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCRs were run in a 7500 real-time PCR system (Roche) using the following settings ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... and RT-PCR was performed using Taqman reagents (Roche) using a StepOnePlus (ThermoFisher) ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative RT-PCR was performed on a LightCycler480 (Roche) using SensiFAST SYBR NO ROX kit (Bioline) ...
-
bioRxiv - Immunology 2023Quote: ... in a LightCycler96 RT PCR system (Roche Life Science). ACTB and GAPDH were utilized for normalization.
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using an LightCycler® 480 II (Roche) and SYBR Green PCR Master Mix (Vazyme ...
-
bioRxiv - Immunology 2020Quote: ... and HCV specific PCR primers in LightCycler 480 instrument (Roche). By absolute quantification method ...
-
bioRxiv - Cell Biology 2022Quote: ... primers used with FastStart SYBR Green PCR Master Mix (Roche) are described in Table S4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR data were acquired with a LightCycler 480 (Roche).
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was performed using SYBR Green I Master (Roche) and RT-PCR–specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed on a LightCycler96 qPCR machine (Roche) with initial incubations at 48°C for 15 mins and 95°C for 10 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative RT-PCR was performed on a LightCycler96 system (Roche) with FastStart Essential DNA Green Master kit (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RT–qPCR was performed in a LightCycler PCR instrument (Roche) using SYBR Green Master Mix (Roche).
-
bioRxiv - Genetics 2023Quote: ... RT-PCR was performed using KAPA HiFi HotStart ReadyMix (Roche) under conditions that resulted in 1% of the concentration of the original cDNA solution ...
-
bioRxiv - Immunology 2023Quote: Quantitative RT-PCR was performed on LightCycler 480 II (Roche) using TaqMan gene expression assay (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR cycling condition set in Light Cycler 480 instrument (Roche Diagnostics, USA)and was run at 95°C for 3 min initial denaturation followed by 50 cycles each comprising of 95°C denaturation for 30 s ...
-
bioRxiv - Genomics 2019Quote: ... 50-µL PCR reactions were set using 2x KAPA HiFi Hotstart reagents (Roche) with 2µL extracted gDNA ...
-
bioRxiv - Genomics 2019Quote: ... 100-µL PCR reactions were set using 2x KAPA HiFi Hotstart reagents (Roche) with 1µL extracted gDNA ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... A thermocycling program was set on a qRT-PCR machine (Roche LightCycler 480II) (Figure 6b) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... One-step qRT-PCR was performed using the Transcriptor One-Step RT-PCR Kit (Roche) by using 5μL of samples per each 20 μL reaction volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...