Labshake search
Citations for Roche :
1 - 50 of 4959 citations for WesternBright MCF Fluorescent Western Blot Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The Lumi-Light Western blot substrate (Roche) was used for detection.
-
bioRxiv - Molecular Biology 2023Quote: ... Western blot using anti-GFP (Roche, 11814460001), anti-HA (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Lumi-Light Western-Blot-Substrate (Roche, Basel, Schweiz) were used ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA ...
-
bioRxiv - Microbiology 2022Quote: ... blots were developed with Lumi-Light Western Blotting Substrate (Roche) for 5 min in the dark and visualized on a chemiluminescence imager (Bio-Rad ChemiDoc MP).
-
bioRxiv - Microbiology 2023Quote: ... Membranes were developed using Lumi-light Western blot substrate (Roche) to detect HRP and a ChemiDoc (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... For western blot an anti-HA high affinity (Roche, cat: 11867423001) and a rat HRP were used ...
-
bioRxiv - Cell Biology 2021Quote: Antibodies used for western blots were α-HA clone 12CA5 (Roche), α-myc 9E10 (Babco) ...
-
Receptor-like role for PQLC2 amino acid transporter in the lysosomal sensing of cationic amino acidsbioRxiv - Cell Biology 2020Quote: ... The antibodies used for western blot analysis were HA (3F10, Roche, 1:2000), GFP-HRP (Rockland ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies used in Western blot analysis: monoclonal α-GFP (1:1000; mouse; Roche), α-GAPDH (1:3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding efficiency was determined by Western Blot analysis using an EGFP-antibody (Roche 11814460001) and the ImageQuant LAS-4000 system (Fuji ...
-
bioRxiv - Plant Biology 2020Quote: ... The eluates were used for western blot analysis using anti-HA (3F10)-HRP (Roche, Switzerland) and anti-FLAG M2-HRP (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: Western blot analysis was performed using the following primary antibodies: an anti-GFP antibody (Roche, Anti-GFPfrom mouse IgG1k (clones 7.1 and 13.1) ...
-
bioRxiv - Neuroscience 2019Quote: ... Mice PSD-95 western-blot PSD-95 monoclonal antibody (1:1000, Roche Group, Nutley, USA), and Trizol ...
-
bioRxiv - Genomics 2022Quote: ... Co-purification was investigated by western blot with an anti-GFP antibody (Roche #11814460001, RRID:AB_390913). Two independent biological replicates were performed ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins of inputs were analyzed by Western Blot with the Anti-GFP from mouse (Roche) and Monoclonal ANTI-FALG® M2 antibody produced in mouse (Sigma Aldrich).
-
bioRxiv - Cancer Biology 2023Quote: ... by western blot with HRP-conjugated anti-HA antibody (clone 3F10 Roche 12013819001, 1:1,000); and POU5F1B downregulation upon shRNA transduction in LS1034 was analyzed by quantitative real-time PCR using P3 pair of primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Western blot was stained with the following primary antibodies: mouse anti-GFP antibody (11814460001, Roche) and rabbit anti-HA antibody (H6908 ...
-
bioRxiv - Physiology 2019Quote: ... For Western blots and immunoprecipitation experiments the following primary antibodies were used: anti-HA (Roche, 11867423001), anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Western blot analysis was performed using peroxide-conjugated anti-hemaglutinin antibody at 1:250 dilution (Roche), anti-cMYC antibody 9E10 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Western blots were performed by standard methods using rat anti-HA (1:1000; clone 3F10, ROCHE), rabbit anti-GFP (1:2000 ...
-
bioRxiv - Cell Biology 2021Quote: Commercially available primary antibodies used for western blot are rat anti-HA tag (clone 3F10; Roche), rabbit anti-Cyclin B1 (4138S ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked with 5% milk in TBS-T or 10% Western Blot Blocking Reagent (Roche) followed by primary antibody incubation overnight at 4°C ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... Western blot analysis was followed with an antibody against GFP (1:1000, mouse anti-GFP, Roche) and goat anti-Mouse IgG-HRP (1:3000 ...
-
bioRxiv - Biophysics 2022Quote: ... The PVDF membranes were developed using an enhanced chemiluminescence western blot detection kit (Pierce SuperSignal® West Dura, Rockford, IL) and exposed to Lumi-Film chemiluminescent detection films (Roche Diagnostics, Mannheim, Germany). The experiment was replicated five times ...
-
bioRxiv - Microbiology 2019Quote: ... Western blots were performed as described previously using an anti-GFP primary antibody (1/5,000 dilution, Roche) followed by an anti-mouse peroxidase-conjugated secondary antibody (1/25,000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... Western blot analysis was performed by a standard protocol using an antibody against GFP (α-GFP, Roche) and a secondary antibody coupled with alkaline phosphatase (Pierce Goat Anti-Mouse ...
-
bioRxiv - Cell Biology 2020Quote: Western blots were performed using the following antibodies: anti-myc antibody (Roche 0.4 mg/ml, 1/1000) followed by incubation with goat anti mouse HRP (BioRad 1/10000) ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The primary and secondary antibodies used in western blot analysis were: mouse anti-GFP (1:1000, Roche), mouse anti-PLK4 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were subjected to Western blot analysis with mouse monoclonal anti-GFP antibody (1:2,000 dilution, Roche), rabbit polyclonal anti-Sec2 antibody (1:2000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and Lumi-Light Western Blotting Substrate Kit (Roche). FLAG-tagged FLAG-FimV Protein (Rossmann et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... for Western blot analysis probing for HA and FLAG epitopes using 1° antibody = 1:500 mouse αHA (Roche), or 1:500 mouse αFLAG (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: Lysates for Western-blot were made in a 1% triton buffer including cOmplete protease inhibitor cocktail (Roche 11697498001) and Western-Blot and flow cytometric staining was performed as described previously (41),(42) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG/HA-AGO2 expression and immunoprecipitation efficiency were determined by Western blot using anti-HA antibody (clone 3F10, Roche). RNA was extracted by adding Trizol reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ZNF274 expression was induced with 1µg/ml doxycycline and verified via western blot with an anti-HA antibody (1:1000, ref.12013819001, Roche) and anti-beta actin antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000).
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative Western blot analysis was employed to determine concentration of recombinant protein using a recombinant GFP standard (Roche, 11814524001) with a defined concentration of 1 mg/ml ...
-
bioRxiv - Cell Biology 2020Quote: Expression level of Nud1-HA3 and Nud17A-HA3 was determined by western blot analysis of whole cell extracts as previously described (Ten Hoopen et al., 2012) using monoclonal antibody 12CA5 (Roche) at 1:1000 dilution and monoclonal antibody B-5-1-2 (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC cells for Western blot analysis were lysed directly in 2x Laemmli Sample Buffer containing 5% b-ME and a PhosSTOP tablet (Roche), 500ul per T-25 culture flask.
-
bioRxiv - Developmental Biology 2021Quote: ... after fixation in 4% formaldehyde and bleaching (Pearson et al., 2009) using blocking solution containing 10% horse serum and western blot blocking reagent (Roche) (King and Newmark ...
-
bioRxiv - Cell Biology 2020Quote: ... Denatured and fully-reduced proteins were resolved on Tris-glycine SDS-PAGE followed by western blot analysis using the following antibodies: rat monoclonal anti-HA (11867423001; Roche), mouse monoclonal anti-V5 (V8012 ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes was incubated secondary antibody for an hour in 5% milk and developed using Lumi-light western blot substrate (Roche) to detect HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... From each cell lysate 10 µg of protein were loaded to an SDS-Page (10 % self-made gel) and then blotted to a PVDF western blot membrane (Ref: 3010040001, Roche). The membrane was incubated with rabbit monoclonal antibody against total ERK (Ref ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein aggregation was evaluated by western blot in total cell extracts prepared in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). Protein quantification was performed with the Pierce BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Synthetic Biology 2021Quote: ... the efficiency of biotinylation was checked in a Western blot revealed with POD-anti-biotin (horseradish peroxidase conjugated with Streptavidin, Roche).
-
bioRxiv - Neuroscience 2020Quote: ... Protein aggregation was evaluated by western blot in total cell extracts prepared in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). Sample quantification was performed with the Pierce BCA Protein Assay Kit (Thermo Scientific).