Labshake search
Citations for Roche :
1 - 50 of 3318 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA libraries were quantified using KAPA Library Quantification Kits (Kapa Biosystems) and were used as a template for high throughput sequencing ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were quantified using KAPA Library Quantification Kits (Kapa Biosystems). After cluster generation on a cBot ...
-
bioRxiv - Molecular Biology 2019Quote: Two microliters RNA was used to generate cDNA using Transcriptor (Roche), random hexamer primer ...
-
bioRxiv - Genomics 2022Quote: ... two libraries were constructed using the Kapa Hyper Prep kit (Roche) according to Arima’s recommendation (Library Preparation using KAPA Hyper Prep Kit DOC A160108 v01) ...
-
bioRxiv - Genomics 2021Quote: ... cDNA synthesis from two biological replicates was performed using the Transcriptor High-fidelity cDNA synthesis kit (Roche) and real-time PCR using SYBR green (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA libraries were synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR reactions were performed using SYBR Green I Master on a LightCycler480 (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cDNA libraries were prepared using the Transcriptor First Strand cDNA Synthesis Kit (Roche). For RT-qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA libraries were quantitated using KAPA library quantification kit for Illumina platforms (Kapa Biosystems). The individual indexed libraries were diluted to 4 nM and pooled in equal quantity ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems, Wilmington, MA). Finally ...
-
bioRxiv - Genetics 2023Quote: ... At least two libraries were independently prepared with the Expand Long Template polymerase (Roche) using the primers listed in Supplementary Table 9 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse-transcribed cDNA libraries containing the TCR sequences were quantified using KAPA Library Quantification Kit (KAPA Biosystems), and loaded at 4 nM into the MiSeq sequencer (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... DNA/cDNA libraries with index adapters were then prepared using the KAPA Library Preparation Kit (Roche NimbleGen) and the KAPA Stranded RNA-Seq Library Preparation Kit (Roche NimbleGen ...
-
bioRxiv - Genomics 2024Quote: ... the cDNA libraries were quantified using the KAPA Library Quantification kit (KR0405-v11.20, Kapa Biosystems, Woburn, USA). Paired-end reads of 150 bp were generated using TruSeq RNA Access sequencing chemistry on HiSeq X instrument (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and library cDNA concentrations were quantified by qPCR (Kapa Biosystems KK4923) on a CFX96 Touch Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA libraries were generated with KAPA RNA HyperPrep kits (Roche; 08098197702), and sequenced on the Illumina NovaSeq 6000 sequencing system ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared using the KAPA mRNA HyperPrep Kit (Roche) and subsequently sequenced on a NextSeq 500 sequencer (paired-end 43 bp ...
-
bioRxiv - Pathology 2023Quote: ... cDNA libraries were generated using the KAPA mRNA HyperPrep kit (Roche). RNA-Seq libraries were sequenced on an Illumina NovaSeq 6000 (30 million reads per sample) ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were prepared using the KAPA mRNA HyperPrep Kit (Roche) and subsequently sequenced on a NextSeq 500 sequencer (paired-end 43 base pairs ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: ... Two µg of total RNA were retro-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Science ...
-
bioRxiv - Developmental Biology 2021Quote: cDNA libraries were prepared using KAPA Stranded mRNA-seq kit (KAPA Biosystems) for the MZ/IZ/CZ bulk RNA-Seq experiment and the Universal Plus mRNA-Seq kit (Nugen ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA Libraries were generated using KAPA Hyper Prep Kit (Kapa Biosystems, kk8505). After adaptor ligation ...
-
bioRxiv - Immunology 2021Quote: ... cDNA library generation was produced with a KAPA RNA HyperPrep Kit (Roche) and sequenced on Illumina HiSeq2500 platform ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cDNA library preparation was performed using a KAPA Hyperprep kit (Roche) and cDNA libraries were subjected to a RNA-sequencing run on a Next-seq 500 instrument (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries were amplified with KAPA Hifi HotStart ReadyMix (KAPA Biosystems, KK2602) and custom PCR primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were ligated using Illumina TruSeq single index adapters (Roche #KK8700), amplified ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA library was prepared using KAPA Stranded mRNA-Seq Kit (KAPA Biosystems) and sequenced using Illumina HiSeq 2500 ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA libraries were prepared using KAPA mRNA Hyperprep Kit (Roche #KK8580) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and one cDNA reaction product was split into two for PCR amplification using KAPA HiFi master mix (Roche) together with USER enzyme (NEB ...
-
bioRxiv - Genomics 2019Quote: ... from each specimen underwent cDNA synthesis and construction of sequencing libraries using a KAPA Stranded RNA-Seq Library Preparation Kit (Roche Sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA libraries were prepared using a KAPA Stranded RNA-Seq Kit (Roche). Quality control steps included initial Qubit quantification along with RNA fragment size assessment on an Agilent 2100 Bioanalzyer before and after rRNA depletion ...
-
bioRxiv - Genomics 2020Quote: ... followed by cDNA library preparation using the KAPA Stranded mRNA-Seq kit (Roche) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche, (07962193001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA libraries were prepared with KAPA RNA Hyaperprep kit KR1350 – v2.17 (Roche). Data quality was checked by Fastqc v0.11.8 ...
-
bioRxiv - Genomics 2023Quote: ... cDNA libraries were prepared using the KAPA Stranded RNA-Seq Kit (Roche; 07962142001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Genetics 2024Quote: ... the sequencing libraries were constructed with two rounds of PCR using KAPA HiFi HotStart ReadyMix polymerase (Roche, 7958927001). For the first round of PCR ...
-
bioRxiv - Immunology 2019Quote: ... cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for library quantitation (Kapa Biosystems) prior to sequencing.
-
Cell Ecosystem and Signaling Pathways of Primary and Metastatic Pediatric Posterior Fossa EpendymomabioRxiv - Cancer Biology 2020Quote: ... cDNA quality of the libraries was evaluated with a bioanalyzer and quantified using a KAPA Library Preparation Kit (Roche sequencing, KK4824). Libraries were sequenced using an Illumina NextSeq 500 on high output mode with 20 bp (read 1 ...
-
bioRxiv - Microbiology 2020Quote: ... The final cDNA libraries were evaluated on the BioAnalyzer and quantified using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA) by Molecular Genomics Core Facility (Moffitt Cancer Center ...
-
bioRxiv - Genomics 2021Quote: ... Strand-specific Illumina cDNA libraries were prepared using the KAPA Stranded RNA-Seq library preparation kit with 10 cycles of PCR (KAPA Biosystems). Library quality was assessed by BioAnalyzer (Agilent ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA was amplified and quantified using the Universal Probe Library (Roche, Burgess Hill, UK) system on a Roche LightCycler 480 (Roche Diagnostics Ltd ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA was amplified and quantified using the Universal Probe Library (Roche, Burgess Hill, UK) system on a Roche LightCycler 480 (Roche Diagnostics Ltd ...
-
bioRxiv - Cell Biology 2021Quote: ... and cDNA libraries were prepared using the Kapa RNA HyperPrep Kit (96 rxns, Roche) and TruSeq DNA UDI 96 indexes (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Indexed cDNA libraries were prepared using the KAPA hyper RNA kit (KK8541, Roche, Switzerland), substituting proprietary adapters and indexing primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries generated using the Kapa stranded mRNA Kit (Roche Kapa Biosystems, Indianapolis, IN) were pooled to equimolar concentrations and sequenced on the NovaSeq 6000 S-Prime flow cell to produce 100 bp paired-end reads ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries generated using the Kapa stranded mRNA Kit (Roche Kapa Biosystems, Indianapolis, IN) were pooled to equimolar concentrations and sequenced on the NovaSeq 6000 S-Prime flow cell to produce 100 bp paired-end reads ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Real-Time qPCR was performed twice on each cDNA sample (two technical replicates of analysis) by using Lightcycler 480 SYBR Green I Master (ROCHE) chemistry in combination with the Lightcycler 480 II system (ROCHE) ...
-
bioRxiv - Biochemistry 2022Quote: ... Three biological replicates of sRNA from infected and noninfected MT-4 cells and cDNA samples after NAD captureSeq were measured in two technical repeats on LightCycler 480 II (Roche) by Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and retrotranscribed cDNA quantified using the Universal Human Probe Roche library (Roche-Diagnostics, Barcelona, Spain). Assays were made in triplicate and normalized to TBP expression (ΔΔCT method) ...
-
bioRxiv - Genomics 2024Quote: ... We used 10 ng of DNA from two biological replicates to generate sequencing libraries using KAPA Hyper Prep Kit (KAPA Biosystems) according to the manufacturer’s instructions ...