Labshake search
Citations for Roche :
1 - 50 of 171 citations for TNF beta Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of beta-globin was performed by a commercially available human genomic DNA kit (The LightCycler Control Kit DNA, Roche Diagnostics, Basel, Switzerland)69.
-
bioRxiv - Microbiology 2020Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Microbiology 2022Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% beta-mercaptoethanol and protease and phosphatase inhibitors (Roche Complete Mini protease inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... 25 mM beta-glycerophosphate and protease inhibitor cocktail (Roche Applied Science, Penzberg, Germany). Protein concentration of the samples was measured with BCA protein assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.011 gr/ml beta-glycerophosphate) supplemented with 1x PhosSTOP phosphatase inhibitors (#4906837001, Roche) and 1x cOmplete protease inhibitors (#11836153001 ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol) supplemented with 5% v/v beta mercaptoethanol and 1x protease inhibitor cocktail (Roche) was added to each sample followed by centrifugation at 18,000×g at 4 °C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM beta-mercaptoethanol) in the presence of a protease inhibitor cocktail (Roche, Basel, Switzerland). These mixtures were incubated on ice for 30 min ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Cell Biology 2022Quote: ... Pellets were resuspended in 120 μl lysis buffer (0.1 M NaOH, 0.05M EDTA, 2% SDS, 2% beta-mercaptoethanol, PhosStop (Roche), cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biophysics 2022Quote: ... 200 mM NaCl, 5 mM Beta glycerophosphate, 0.1 mM sodium orthovanadate, 2 mM TCEP, 0.4% NP40, 1X Roche EDTA free mini complete protease inhibitor) ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Systems Biology 2020Quote: ... Supernatants were discarded and protein resuspended in Guanidine-HCl buffer (6M Gnd-HCl, 50mM Tris-HCl, pH 8.5, 5mM NaF, 5mM beta-glycerophosphate, 1mM Na-orthovanadate, containing Roche complete protease inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM beta-mercaptoethanol) in the presence of 0.1 mM PMSF and a protease inhibitor cocktail (cOmplete, EDTA-free; Roche). Triton X-100 (f.c ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% beta-mercaptoethanol and protease and phosphatase inhibitors (Roche Complete Mini protease inhibitor, Sigma-Aldrich #11836153001, and Roche Complete Ultra phosphatase inhibitor ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were washed once with room temperature PBS and then lysed in a solution of 1 volume 5x SDS-PAGE sample buffer (containing fresh 5% (v/v) beta-mercaptoethanol) to 4 volumes of Immunoprecipitation buffer (IPB; (Thomas et al. 2012)) containing fresh Protease Inhibitor Cocktail (Roche) and 1 μM microcystin-LR ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...
-
bioRxiv - Physiology 2019Quote: ... Serial dilutions of human genomic DNA (Roche) (final concentrations from 0.5 ng/mL to 5000 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Human IL-2 (TECIN™ teceleukin, ROCHE, was generously provided by the NCI Biological Resources Branch ...
-
bioRxiv - Molecular Biology 2021Quote: ... and human genomic DNA (Roche Diagnostics, Germany) were used as templates for the experiments in Figure 2 and S1a ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-CD20 human Ab (obinutuzumab, Roche). Relevant negative controls were performed using isotype antibodies and cells incubated with anti-CD20 human and anti-CD20 mouse antibody served as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Ct values for Asns and the housekeeping gene Actb (Beta-actin) were determined by quantitative real-time PCR on a LightCycler® 480 II Real-Time PCR System (Roche Life Science), using the TB Green™ Premix Ex Taq™ (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: Total cell lysates from human RMS cell lines and human myoblasts were obtained following lysis in RIPA lysis buffer supplemented with protease inhibitors (Roche). Western blot analysis was performed similar to Ignatius et ...
-
bioRxiv - Biophysics 2019Quote: ... We employed fibronectin (FN, from human plasma, Roche Applied Science ...
-
bioRxiv - Neuroscience 2022Quote: ... The media for human NPCs obtained from Roche was supplemented with B-27-supplement minus vitamin A (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... human NEMO (5µg) and ATP (2mM) (Roche, 1051997900) were incubated in a reaction buffer consisting of 50mM HEPES (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... Human IFN-α2a (Roferon) was purchased from Roche. 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng of human genomic DNA (11691112001, Roche) was tagmented in 25 μl reactions by adding 12.5 μl of 2X tagmentation buffer (20mM Tris-HCl pH 7.8 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human gDNA of high molecular weight (Roche Diagnostics) and ssDNA (M13mp18 single-stranded virion DNA ...