Labshake search
Citations for Roche :
1 - 29 of 29 citations for Super Resolution microscope since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 1M Resolution Solution (GC-RICH PCR, Roche) was added to each qPCR reaction (47) ...
-
bioRxiv - Neuroscience 2020Quote: ... Genotyping was conducted by real-time polymerase chain reaction (RT-PCR) and subsequent high resolution high-resolution melting on a Cobas Z480 Light Cycler (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... LightCycler® 480 High Resolution Melting Dye (Roche, cat. nr. 04909640001) and specific primers amplifying the Slc2a10 transcript or Expressed Repeat Elements (EREs ...
-
bioRxiv - Developmental Biology 2020Quote: ... HRMA was performed using the LightCycler 480 High-Resolution Melting Master (Roche) kit according to the manufacturer’s instructions on a LightCycler 96 Real-Time PCR System (Roche).
-
bioRxiv - Microbiology 2022Quote: ... used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat ...
-
bioRxiv - Microbiology 2021Quote: ... we used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat ...
-
bioRxiv - Microbiology 2022Quote: ... we used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... HRM analysis was performed using the High Resolution Melting Master (Roche Applied Science, Germany) on the LightCycler® 480 II system (Roche Applied Science ...
-
bioRxiv - Microbiology 2020Quote: ... the super pools were quantified using the Kapa qPCR Illumina quantification kit (Kapa Biosystems) prior to sequencing ...
-
bioRxiv - Pathology 2023Quote: ... Mice were genotyped using high-resolution amplicon melting via the LightCycler 480 System (Roche Diagnostics). Wildtype and Bmp6 KO mice (only males ...
-
bioRxiv - Microbiology 2022Quote: ... used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat. No. 04909631001, Roche Diagnostics Australia Pty ...
-
bioRxiv - Microbiology 2021Quote: ... we used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat. No. 04909631001, Roche Diagnostics Australia Pty ...
-
bioRxiv - Microbiology 2022Quote: ... we used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat. No. 04909631001, Roche Diagnostics Australia Pty ...
-
bioRxiv - Plant Biology 2021Quote: Genotyping was performed with High Resolution Melting Analysis (HRMA) on a LightCycler® 480 System (Roche, Basel, Switzerland) using the same conditions as Do Canto et al ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The Roche LightCycler® 480 High Resolution Melting Master mix and the LightCycler® 96 (Roche Life Science) were used to amplify and detect the transcripts of interest ...
-
bioRxiv - Neuroscience 2020Quote: The PCR reactions were performed with 5 μL of LightCycler® 480 High Resolution Melting Master (Roche, #04909631001), 0.5 μL of each primer (10 μM) ...
-
bioRxiv - Cancer Biology 2023Quote: Whole slides were scanned at x40 resolution (0.25 um per pixel) on a Ventana DP200 slide scanner (Roche) for chromogenic slides ...
-
bioRxiv - Cancer Biology 2021Quote: ... The candidate cells were selected with 2 µg/ml puromycin for a week and the selected cells were analysed by High-resolution melting peaks analysis using real-time PCR (Light cycler 480 II, Roche).
-
bioRxiv - Microbiology 2021Quote: ... GTP binding Irgb6 crystals diffracting to 1.5 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GTP (Roche) and a reservoir solution consisting of 0.1 M Sodium Citrate buffer pH 5.4 (Wako) ...
-
bioRxiv - Microbiology 2022Quote: ... GTP-binding Irgb6-T95D crystals diffracting to 1.68 Å resolution were obtained from sitting drops with a 0.5 μl of protein solution containing 2 mM GTP (Roche) and a 0.5 μl of reservoir solution consisting of 0.2 M Sodium sulfate (Molecular Dimensions ...
-
bioRxiv - Plant Biology 2022Quote: ... The identified cdkd;3-3 mutation was genotyped by the High-Resolution Melting (HRM) qPCR-based method using primers described in Table S3 using Lightcycler96 thermocycler (Roche) using the inbuilt HRM profile.
-
bioRxiv - Cell Biology 2021Quote: ... Université libre de Bruxelles, Belgium) expressing a Wnt reporter gene (super top flash, STF) with X-tremeGENE HP DNA Transfection Reagent (Roche). The luciferase activity was detected 48 hours after transfection using the luciferase assay system (Promega ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Neuroscience 2023Quote: ... using TGGAGCTGTTACCCACATCA and GCACAGTTCAGCGGGTACTT primers followed by a melting point analysis using the High Resolution Melting and Gene scanning application on the LightCycler 480 (Roche Diagnostics) was performed according to [3] ...
-
bioRxiv - Developmental Biology 2023Quote: ... The qPCR was performed using PerfectStartTM Green qPCR Super Mix (TransGen Biotech, 1) on a Real-time PCR Detection System (Roche, LightCycle480 II). RPLP0 served as an internal control ...
-
bioRxiv - Genetics 2023Quote: ... AB individuals with the shortest wild introgressed fragment were selfed and the progeny was genotyped by High Resolution Melting (HRM) on a LightCycler 480 Real-Time PCR (Roche Diagnostics, Meylan, France) to identify recombinants with shorter introgressions ...
-
bioRxiv - Neuroscience 2023Quote: ... Sphere number and size was quantified using a CellAvista automated microscope system (Roche). Conditioned media was collected from supernatant at first passage and assayed with the Mouse VEGF DuoSet ELISA (R&D Systems ...
-
bioRxiv - Developmental Biology 2023Quote: Footpads and tips of mouse digits were dissected under a stereoscope microscope and digested for 45 min in 1g liberase TL (Roche)/1mL HBSS with calcium at 37C ...
-
bioRxiv - Biophysics 2024Quote: ... cells were imaged using FLUOVIEW FV3000 confocal laser scanning microscope (Evident) and then lysed with BIORUPTOR II (BM Bio) in 1xPBS supplemented 1x cOmplete™ Protease Inhibitor Cocktail (Roche) in Protein LoBind Tubes (Eppendorf) ...