Labshake search
Citations for Roche :
1 - 50 of 630 citations for Recombinant Human Fc Fragment Of LgG Receptor Transporter Alpha since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Immunology 2021Quote: ... Cell suspensions were first pre-incubated with 2.4G2 antibody (kindly provided by Louis Boon) for blocking Fc receptors and next stained for surface markers in PBS supplemented with 0.5% BSA (Roche) and 2 mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... against mouse NaBC1 transporter in X-tremeGENE siRNA Transfection Reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Microbiology 2022Quote: ... according to the manufacturer’s instructions and maintained in RPMI GlutaMax supplemented with 10% FCS and 30 U/ml recombinant IL-2 (Roche).
-
bioRxiv - Neuroscience 2023Quote: Recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche, Welwyn Garden City, UK) or placebo (PL ...
-
bioRxiv - Microbiology 2019Quote: ... Glutamax and Pen/Strep and with 100 U/mL recombinant human IL-2 (Roche; Sigma # 10799068001). For the analysis of reverse transcription products ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
bioRxiv - Cancer Biology 2022Quote: ... progesterone receptor (PR) (790–4296, Roche) and human epidermal growth factor 2 (HER-2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Fab fragments (Roche) for 3 hours at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fab fragment (ROCHE) and anti-fluorescein-AP ...
-
bioRxiv - Pathology 2022Quote: ... Fab fragments (Roche Molecular Biochemicals ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fab fragments (Roche) in blocking buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fab fragments (Roche) and TMB Peroxidase Substrate (KPL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fab fragment (Roche) antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant HBsAg (Roche Diagnostics International) was used as a marker for aerosol formation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with recombinant DNase I (Roche) treatment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and recombinant proteinase K (Roche). Samples were run on a 1% certified megabase agarose (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fab fragment antibody (Roche) solution in blocking buffer at room temperature for 2 hours with no blocking step ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fab fragments (#11093274910, Roche) in Blocking Reagent for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fab fragments (#11093274910, Roche) were added at 1:1000 dilution and incubated for 2 h at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fab fragment antibody (Roche) at 1:3000 dilution and incubated overnight at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... Fab fragment (Roche 11093274910) and for Fluorescein with Anti-Fluorescein-AP ...
-
bioRxiv - Microbiology 2020Quote: ... Pegylated interferon alpha-2a (PEG-IFN-α; Pegasys, 90 mcg, Roche) was aliquoted and stored at room temperature until further use ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Cell Biology 2022Quote: ... Fab fragments (Roche, Mannheim, Germany) at 4ºC overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Fab fragments (1:80, Roche), amplified using TSA Plus Biotin kit (PerkinElmer ...
-
bioRxiv - Neuroscience 2020Quote: ... Fab fragments (Roche, 1:3000) and TSA Plus Cyanine 3 System (Perkin Elmer ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Fab fragments (Roche, Mannheim, Germany) for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fab fragments antibody (Roche, 11426339810) was added (1:2000 dilution in PBT + 2 mg/ml BSA + 2% sheep serum ...
-
bioRxiv - Microbiology 2024Quote: ... Fab fragments (Roche, Mannheim, Germany). Unbound antibodies were eliminated by washing with 50 mL maleic acid buffer + 150 µL Tween 20 (Sigma Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... 1% FCS and 12.5µg/ml DNAse (Roche) in IMDM (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...