Labshake search
Citations for Roche :
1 - 50 of 986 citations for RPA reagent since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... XTT reagent (Roche) was prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% blocking reagent (Roche), 10 mM Tris-HCl (pH 7.4) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% blocking reagent (Roche) and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Bluing reagent (Roche) were performed with the Ventana Bench-Mark XT automated staining system (Ventana ...
-
bioRxiv - Developmental Biology 2021Quote: ... commercial blocking reagent (Roche) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... and PhosStop reagent (Roche). Lysates were passed five times through a narrow-bore tip before centrifugation (10000 g for 3 min at 4°C) ...
-
bioRxiv - Cell Biology 2021Quote: ... and TRIpure reagent (Roche). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.05% blocking reagent (Roche)) containing 0.5 ug/ml Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking Reagent (Roche, Switzerland), MAB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% blocking reagent (Roche), 20% heat inactivated goat serum and then incubated overnight with anti-DIG antibody (Roche ...
-
bioRxiv - Genetics 2019Quote: ... with reagents from Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% Blocking reagent (Roche) and 10% goat serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5% blocking reagent (Roche). The first probe (0.8μM ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 % blocking reagent (Roche), 10 mM Tris-HCl (pH 7.2)) ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking reagent (Roche, 11096176001), PBS (Genesee ...
-
bioRxiv - Cell Biology 2023Quote: ... jetPEI-DNA transfection reagent (Polyplus-transfection) and X-tremeGENETM 9 DNA Transfection Reagent (Roche) were used to perform plasmid transient transfection according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% blocking reagent (Roche, Germany)] containing 2.5 μg/mlCy-3-labelled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2022Quote: ... using XtremeGene9 transfection reagent (Roche). Similarly ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Blocking reagent (Roche, 11096176001), 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2020Quote: ... using 2 % blocking reagent (Roche), followed by the detection of the Dig-labelled riboprobe with an anti-DIG Fab fragment conjugated with alkaline phosphatase (1:750 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Fugene 6 transfection reagent (Roche) was used for all other transfection experiments.
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking reagent (Roche – 1096176001), 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910 ...
-
bioRxiv - Physiology 2022Quote: ... 0.25% Blocking Reagent (Roche 11096176001), and 0.5μg/ml Telomeric PNA-Cy3 probe (Panagene)-were added to each slide ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% Blocking reagent (Roche 11096176001) and 10 mM Tris ...
-
bioRxiv - Physiology 2021Quote: ... Reagent (Roche Diagnostic, Mannheim, Germany) was directly infused into the eluate online and the absorbance was measured ...
-
bioRxiv - Physiology 2022Quote: ... 1.98% Blocking Reagent (11096176001, Roche), 49.5% formamide ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% blocking reagent (Roche, 11096176001), 1% bovine serum albumin (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... using standard reagents (Roche Diagnostics).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ml TriPure Reagent (Roche) was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% blocking reagent (Roche #11096176001) in MABT at room temperature for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Cell Biology 2023Quote: ... WST-1 reagent (Roche Diagnostics) was added to the culture medium in a 1:10 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Genomics 2020Quote: ... Then WST-1 assay was performed by adding WST-1 reagent (cell proliferation reagent, Roche) directly to the culture wells ...
-
bioRxiv - Cell Biology 2019Quote: ... blocked with blocking reagent (Roche/Merk) and incubated with anti-DIG antibody conjugated with alkaline phosphatase (AP) ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 1xWestern Blocking Reagent (Roche) and labeled for IF imaging ...
-
bioRxiv - Molecular Biology 2019Quote: ... and blocked using Blocking Reagent (Roche). DIG-labeled probes were detected using mouse monoclonal anti-DIG primary antibody (Roche ...
-
bioRxiv - Immunology 2019Quote: ... using the XtremeGene9 transfection reagent (Roche). Media change was performed after overnight incubation and viral supernatant was harvested after additional 36h ...
-
bioRxiv - Developmental Biology 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001), in PBT at 4°C.
-
bioRxiv - Neuroscience 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001) for 24 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... wst-1 reagent (Roche, Basel, Switzerland) was added to each well and incubated for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NBT/BCIP reagent mix (Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... or FuGENEHD transfection Reagent (Roche, E231A). 1 ug plasmid or 50 nM siRNA were applied per 106 cells unless otherwise stated ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Developmental Biology 2019Quote: ... blocked with western blocking reagent (Roche) and incubated with anti-dig or anti-flu ...