Labshake search
Citations for Roche :
1 - 50 of 2973 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and blood glucose test strips (Roche, 06453970037) to measure fasting glucose levels (mg/dL ...
-
bioRxiv - Neuroscience 2024Quote: ... and test strips (06453970, Roche, Basel, Switzerland) on the second drop after a little cut on the tail ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using Advantage reagent strips (Advantage – Roche®, Brazil). Animals that presented glycemia above 250mg/dl during this period and after one week signs of polyuria ...
-
bioRxiv - Physiology 2020Quote: ... and dropped into the glucose test strip (Roche, Switzerland) and measured by the glucometer (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Immunology 2024Quote: ... and Cholesterol (Ref 10745065) levels using respective test strips (Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... using an Accu-Chek Performa glucometer and test strips (Roche, Basel Switzerland).
-
bioRxiv - Molecular Biology 2021Quote: The nitrocellulose membrane strips were digested with 10μl proteinase K (Roche, Ref no.: 03115828001) in 200μl proteinase K SDS buffer (10mM Tris-HCl pH 7.4 ...
-
bioRxiv - Physiology 2023Quote: ... glucose levels were monitored using blood glucose strips and the Accu-Check glucometer (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... Glycemia was measured using single-use test strips and glycemia meter (ACCU-CHEK Performa, Roche). The tip of the tail of the animal was cut for the first measurement ...
-
bioRxiv - Physiology 2021Quote: ... Fasting blood glucose levels were assessed using the Accu-Chek Aviva meter and test strips (Roche) in 0.6 μL of blood ...
-
bioRxiv - Cell Biology 2021Quote: ... and 120 min post-injection using Accu-Chek Performa glucometers and strips (Roche, Castle Hill, Australia) from the tail following initial removal of 1 cm end of the tail-tip.
-
bioRxiv - Cancer Biology 2023Quote: ... at which time blood glucose concentrations were measured using Accu-Chek Performa test strips and meter (Roche). Visualization and statistical analysis of all measurements were performed in GraphPad Prism 9.
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Whole-blood glucose levels were measured using the Accu-check Performa glucometer and accompanying strips (Roche Diagnostics, Canada). For the 6M cohort ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Whole-blood glucose levels were measured using the Accu-check Performa glucometer and accompanying strips (Roche Diagnostics, Canada). During blood sampling from the right lateral tail vein ...
-
bioRxiv - Neuroscience 2022Quote: ... and 120 min after glucose load and analyzed with reactive strips in a glucosimeter (Accuchek Performa, Roche®).
-
bioRxiv - Immunology 2023Quote: ... Blood glucose levels were measured in mice with glycosuria (>110 mmol/L) using Advantage II Glucose strips (Roche). Animals displaying two consecutive blood glucose measurements of ≥ 15mmol/L were considered diabetic.
-
bioRxiv - Molecular Biology 2021Quote: Blood glucose was measured from euthanized mice during the blood collection using Roche’s strip-based glucometer (Accu-Chek Performa, Roche). Serum β-HB and TG were measured using β-HB (Ketone Body ...
-
bioRxiv - Microbiology 2020Quote: ... Other clinical urine markers were measured by using Combur10 Test®M semiquantitative test strips (Roche Diagnostics GmbH, Germany). Each test strip consists of colorimetric reaction spots for 10 markers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the blood was collected directly on the test strips inserted in the glucometer (Accu-Chek® Performa, Roche, Germany). After blood collection ...
-
bioRxiv - Microbiology 2022Quote: ... bilirubin and occult blood) was measured by Cobas6500 urine dry chemical analysis system and supporting test strips (Roche, Switzerland). For the Coagulation indicators ...
-
bioRxiv - Microbiology 2019Quote: ... After washing with 1xPBS containing 0.1% v/v Tween-20, PIP–strips were incubated (1h, RT, agitated) with a monoclonal anti-HA antibody (clone 3F10, monoclonal antibody from Roche) at a dilution of 1:500 in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: Mice were monitored for diabetes weekly by testing for glycosuria using colorimetric Diabur-Test 5000 strips (Roche, Boulogne-Billancourt, France). Overt diabetes was confirmed by testing for fasting glycemia >250 mg.dL-1 (Accu-Check ...
-
bioRxiv - Physiology 2023Quote: ... Blood glucose was determined using a commercial blood glucose meter and test strips (Accu-Chek Performa, Roche Diabetes Care, Inc) and after centrifugation plasma was snap frozen and stored at -80°C until further processing ...
-
bioRxiv - Immunology 2024Quote: ... A drop of blood from the nicked tail vein was used to determine the basal glucose concentration using AccuChec Instant test strips (C216796165-IMP, Roche) after six hours of fasting for GTT and without fasting for ITT ...
-
bioRxiv - Cell Biology 2020Quote: ... baseline glucose was measured in all animals using a drop of blood from a tail snip wound and Accu-check active glucometers and test strips (Roche Diagnostics). Then ...
-
bioRxiv - Biochemistry 2022Quote: An amount of 0.5 ml of whole blood taken from the lithium heparin bottle was used to analyse lactate levels using rapid Accutrend Plus diagnostic meter and BM Lactate test strips (Roche Diagnostics). Accutrend Plus diagnostic meter employs colorimetric lactate oxidase/mediator reaction and has a record of high reproducibility when compared with laboratory diagnosis.(12)
-
bioRxiv - Cancer Biology 2022Quote: Blood was sampled in mice by nicking the tail vein and blood glucose levels were measured using ACCU-CHEK Active test strips read by an ACCU-CHEK Active meter (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: Blood glucose measurements were collected with a glucometer (ACCU−CHEK Performa, USA) and the proper test strips (F. Hoffmann-La Roche AG, Basel, Switzerland). Blood lactate was also measured with the Lactate Pro 2 handheld device and respective test strips (AKRAY Europe B.V. ...
-
bioRxiv - Bioengineering 2021Quote: ... The blood glucose levels of ZDF rats in each group were measured using a digital glucose meter and test strips (Accu-Chek® Sensor, Roche Inc., Mannheim, Germany) 2 or 3 days prior to surgery and at the study endpoint ...
-
bioRxiv - Neuroscience 2021Quote: ... Glycemia was assessed with blood obtained at decapitation using a glucometer with reagent strips (ACCU-CHEK ® Aviva Nano; Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... A tail vein blood sample was applied on Accu-Chek® Performa Test strip (Cat# 06454038020) and glucose concentration was measured with Accu-Chek® Performa (Cat# 05894964014) blood glucose meter (both from Roche Diagnostics, Manheim, Germany).
-
bioRxiv - Pathology 2019Quote: ... 60 min and 120 min after glucose treatment were examined using commercial blood glucose test strips (ACCU-CHEK®, Roche Diabetes Care GmbH, Shanghai, China). For insulin resistance detection ...
-
bioRxiv - Pathology 2020Quote: Fasting blood glucose was measured in blood samples from the tail vein using a glucometer and reactive strips (Accu-Chek® Performa, Roche LTDA. Jaguaré, SP, Brazil). Body weight ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR was performed using KAPAHiFi PCR HotStart Readymix (Roche) with an annealing temperature of 50° and an extension of 15 s for 30 cycles (melting temperature of one of two primers is 47°) ...
-
bioRxiv - Genetics 2019Quote: ... PCR was conducted using FastStart PCR Master Mix (Roche), purified using the QIAquick PCR purification kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was performed using GC-RICH PCR System (Roche). SYNGAP primers (rSG_F ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification using a HiFi PCR kit (Kapa Biosystems) and SINGV6 primer was performed with a modified thermocycling protocol (−98°C for 3 min ...
-
bioRxiv - Genomics 2021Quote: ... 6μL PCR mix (1x KAPA HiFi PCR buffer(Roche), 0.3mM dNTPs/each(Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using the SYBR Green PCR Master Mix (Roche) on a ViiA7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed using KAPA2G Robust PCR kits (KAPA Biosystems). A typical 25 μl reaction used 20–100 ng of genomic DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR used the Kapa Taq PCR kit from Kapa Biosystems (Wilmington ...
-
bioRxiv - Systems Biology 2021Quote: ... Barcoding PCR was done by KAPA HiFi PCR Kit (Roche) in a final 25μl reaction (11.5μl H2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR kit used was FastStrat PCR Master (Roche, 04710436001). The amplification product from mutated allele has a 341bp size and the one obtained from a wild-type allele is 262bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoding PCR was done using KAPA HiFi PCR Kit (Roche) in a final volume of 25 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was achieved using 2X Faststart PCR mastermix (Roche) using primer sets and cycling conditions described in Supplementary Table 1 ...
-
bioRxiv - Genetics 2020Quote: ... PCR KIT (Roche). For each reaction ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions with KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) were setup with 80ng genomic DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR was performed using KAPA2G Robust PCR kits from Kapa Biosystems. The 25 µL reactions used 25 ng of cDNA ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified with High Pure PCR Product Purification Kit (Roche). After sequencing reaction ...