Labshake search
Citations for Roche :
1 - 50 of 62 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Ab anti-HA Ab (rat monoclonal, Roche), anti-GAPDH Ab (mouse monoclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... phosSTOP were from Roche (Roche AB, Solna, Sweden). All lipids were purchased from Avanti Polar Lipids (Alabaster ...
-
bioRxiv - Biochemistry 2020Quote: ... All components were PCR amplified by using KAPA HiFi HotStart ReadyMix (Roche, Switzerland), the template vector was removed by DpnI treatment (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-HA Ab (rat monoclonal, Roche), anti-CaV2.2 II-III loop Ab (rabbit polyclonal ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and chromatin quality analysed using EtBr agarose gel electrophoresis (1.3 % Biozym ME Agarose ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and analysed using ethidium bromide (EtBr ...
-
bioRxiv - Bioengineering 2023Quote: ... pH 7.5) containing lysis components (1.5 mM MgCl2, 25 U/mL Benzonase nuclease, Roche Complete™ Mini ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-CD20 human Ab (obinutuzumab, Roche). Relevant negative controls were performed using isotype antibodies and cells incubated with anti-CD20 human and anti-CD20 mouse antibody served as a positive control ...
-
bioRxiv - Microbiology 2020Quote: ... non-EDTA protease inhibitor (Roche, USA) and 100 mM PMSF (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... phosSTOP were from Roche (Roche AB, Solna, Sweden). All lipids were purchased from Avanti Polar Lipids (Alabaster ...
-
bioRxiv - Neuroscience 2023Quote: ... threshold values for biomarker aggregation also differ (amyloid-β: 192 pg/mL for INNO-BIA AlzBio3, 980 pg/mL for Roche Elecsys ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
bioRxiv - Microbiology 2022Quote: ... the non-specific competitor Poly dI dC (Roche) was added to each reaction before the probe at a final concentration of 2.5 ng/µl (52) ...
-
bioRxiv - Microbiology 2023Quote: ... the non-specific competitor poly-dI-dC (Roche) was added to the EMSA reactions at a final concentration of 2.5 ng/µL ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA prepared using the KAPA Express reagent (a component of the KAPA Mouse Genotyping Kit from Roche, 07961804001) and analyzed for both CRISPR lesions and repeat size as described below.
-
bioRxiv - Genetics 2021Quote: ... plus 1µI of alkaline phosphatase tagged anti-fluorescein F(ab) (Roche), followed by four washes at RT in 100 mM Tris pH7.55 ...
-
bioRxiv - Genomics 2019Quote: ... The dry contents were resuspended by addition of 7.5 µl hybridization buffer and 3 µl hybridization component A (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), mixed by tapping ...
-
bioRxiv - Synthetic Biology 2021Quote: Non-amyloidal samples were treated with protease inhibitor (Roche complete) before fractions separated and harvested ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Genomics 2021Quote: ... and then either the remaining components of the PowerSoil Pro kit or DNA purification beads from Kapa Biosciences (Roche, Burgess Hill, UK) and either the MPBio SuperFastPrep-2 (MPbio ...
-
bioRxiv - Immunology 2021Quote: ... The neutralizing Ab were measured on a Cobas 601 modular analyzer (Roche diagnostics, Switzerland), using a cut-off of 0.8 U/ml to determine Ab levels ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1.2 μl of KAPA HiFi Non-Hot Start Master Mix (Kapa Biosystems) using 12 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and non-fasting glucose concentrations were monitored weekly using Accu-Check glucometer (Roche). Plasma and islet insulin and proinsulin concentrations were measured by commercial ELISA kits (10-1247-01 and 10-1232-01 ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were provided by the Roche Non-Clinical Biorepository from Roche Basel or the Roche-Innovation Center Zurich (RICZ) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...
-
bioRxiv - Genomics 2022Quote: ... fourteen non-coding regions of interest were PCR amplified from human genomic DNA (Roche) using the Phusion High-Fidelity PCR Kit (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... the tryptic digests were cleaved by chymotrypsin (5 ng/μl, sequencing grade, Roche, in 25 mM AB) for 2 hours at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... [U-13C]palmitate was first non-covalently conjugated to ultra fatty acid free BSA (Roche) as previously described (Vacanti et al. ...
-
bioRxiv - Microbiology 2019Quote: ... The HA epitope was detected using horseradish peroxidase (HRP)-conjugated HA antibody (Roche; catalog no. 12013819001 ab 3F10). SAG2 and DP1 were recognized by rabbit polyclonal anti-SAG2 (generated previously (34) ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451) ...
-
bioRxiv - Neuroscience 2023Quote: Cells were lysed in non-denaturing lysis buffer supplemented with EDTA-free protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Immunology 2020Quote: ... To quantify NETs we measured HNE-DNA complexes using ELISA specific for HNE and anti-DNA Ab of Cell Death Detection ELISAPLUS (Roche). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... Glucose production rates were determined at 2 h using an Accu-Chek ®Aviva glucometer (Roche Diagnostics Scandinavia AB, Sweden). Monosaccharide (arabinose ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% non-fat milk TBST and probed with primary anti-GFP (Roche, 1:1000) and secondary HRP- conjugated anti-mouse antibody (R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Non-radioactive antisense RNA probes were generated by in vitro transcription using DIG RNA labeling kit (Roche Diagnostics). For histological analysis sections were stained with Hematoxylin and Eosin according standard protocols.
-
bioRxiv - Neuroscience 2020Quote: ... CAD5 cells were incubated with (0.01%) non-infectious brain homogenate (10% w/v in 0.32M sucrose) to control for efficient proteinase K (PK) (Roche) digestion and to compute the background of the assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were pooled by stage and underwent three rounds of centrifugation at 1500rcf at 4°C for 10 minutes followed by rehydration with DPBS with 0.5% non-acetylated BSA and 0.5U/μl RNAse inhibitor (Roche 3335399001).
-
bioRxiv - Developmental Biology 2022Quote: ... samples from the same stage were pooled and resuspended in DPBS with 0.5% non-acetylated BSA and 0.5U/μl RNAse inhibitor (Roche 3335399001).
-
bioRxiv - Cell Biology 2023Quote: ... the membranes were blocked using non-fat dry milk and stained with an anti-GFP primary (Roche; 1:1000) and a goat anti-mouse secondary antibody coupled to horseradish peroxidase (HRP ...
-
bioRxiv - Immunology 2021Quote: The measurement of anti SARS-CoV-2 neutralizing Abs was performed by electrochemiluminescence sandwich immunoassay (ECLIA) through Roche Elecsys Anti-SARS-CoV-2 S (Roche diagnostics, Switzerland). The neutralizing Ab were measured on a Cobas 601 modular analyzer (Roche diagnostics ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed to determine relative gene expression in pigmented versus non-pigmented mouse melanocytes using a LightCycler 480 instrument (Roche) with PrimeTime Gene Expression Master Mix (IDT DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... for qRT-PCR were intron-spanning to avoid amplification of non-digested genomic DNA fragments and were designed by online Universal ProbeLibrary Assay Design Center (Roche). Standard housekeeping genes (elongation factor 1 ...
-
bioRxiv - Cancer Biology 2019Quote: Intestinal tumor and adjacent non-tumor tissue were lysed in KALB lysis buffer supplemented with protease inhibitor and phosphatase inhibitor (Roche) and then homogenized using a QIAGEN TissueLyser II ...
-
bioRxiv - Cancer Biology 2019Quote: ... was designed to tile a 250 bp capture region within the central 4-kb target region from each 10-kb window of hg19 avoiding non-specific sequences by Roche so that the maximum distance between 2 capture regions is 14-kb ...
-
bioRxiv - Immunology 2022Quote: ... Silent point mutations and non-cleavable point mutants were generated by quick-change PCR using Kapa high-fidelity DNA polymerase (Roche) and all mutations were verified by sequencing.
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... Phosphomimic and non-phospho mutants (S265D and S265A) were generated by site- directed mutagenesis using PWO DNA Polymerase (Roche, #11644955001). Primers containing the appropriate mutations were designed with QuickChange® Primer Design Program (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...