Labshake search
Citations for Roche :
1 - 50 of 5878 citations for Mouse Switch associated protein 70 SWAP70 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... Quantitation of urinary albumin and creatinine was carried out using mouse albumin-specific ELISA kits (Roche) and creatinine determination kits (Enzymatic Method ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Physiology 2019Quote: ... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... BrdU ELISA colorimetric kit was purchased from Roche-Sigma Aldrich (Indianapolis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the CAT ELISA kit (Roche, cat. # 11758241001). The ratios of CAT/βGAL were then analyzed to calculate the relative IRES activity.
-
bioRxiv - Systems Biology 2019Quote: For quantification of CAT expression we used an ELISA based assay (CAT ELISA Kit assay, Roche). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... associated with LightCycler® 480 Software (version 1.5; Roche), was used for the real-time PCR ...
-
bioRxiv - Biochemistry 2021Quote: The Telo TAGGG Telomerase PCR ELISA kit (Roche, Basel, Switzerland) was used to detect the telomerase activity of keratinocytes after UV irradiation ...
-
bioRxiv - Zoology 2021Quote: ... was determined from the cell lysate using an ELISA kit (Roche) in accordance with the company instructions ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: Cell proliferation was assessed by Cell Proliferation ELISA BrdU kit (11647229001, Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... BrdU incorporation was measured using BrdU Elisa kit (Roche Diagnostic, Manheim, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... HA:SQSopsin was immunoprecipitated from the detergent-soluble fraction using 70 μl of 50% protein G resin (Roche) slurry and anti-HA antibody (12CA5) ...
-
bioRxiv - Cell Biology 2020Quote: ... Proliferation was measured using the Cell Proliferation ELISA BrdU kit (Roche Diagnostics GmbH), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptosis was evaluated using the cell death detection ELISA kit (Roche, Basel, Switzerland). HUVEC were trypsinized ...
-
bioRxiv - Immunology 2019Quote: ... mouse lungs were removed and gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... 70 µg RNAse A (Roche), and 100 U ml-1 Supernuclease (Sino Biological ...
-
bioRxiv - Developmental Biology 2021Quote: ... BrdU incorporation was determined colorimetrically with the Cell proliferation ELISA kit (Roche, Basilea, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Apoptosis was measured in freshly isolated islets using the Cell Death ELISA kit (Roche) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... Histone-associated DNA-fragment levels were analyzed using the Cell Death Detection ELISAPLUS (Roche; Cat ...
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was evaluated using a colorimetric bromodeoxyuridine (BrdU) cell proliferation ELISA kit (Roche Diagnostics). After 20-h incubation period with BrdU ...
-
bioRxiv - Cancer Biology 2019Quote: Cell proliferation following different treatments was determined using chemiluminescent BrdU ELISA kit (Roche, catalog # 11669915001) as described by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... BrdU incorporation was measured using the Cell Proliferation ELISA kit (Roche #11-669-915-001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... CAT expression was determined using an ELISA kit in accordance with the manufacturer’s instructions (Roche). Bovine IFN-α standards were used to construct a type I IFN standard curve to interpolate sera sample IFN levels.
-
bioRxiv - Biochemistry 2023Quote: DNA synthesis or replication was monitored by measuring the Cell Proliferation ELISA BrdU kit (Roche). Cells were cultured on a Nunc 96-well plate (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: ... measured by RT ELISA (Roche), per well (MOI 0.2 ...
-
bioRxiv - Genomics 2023Quote: ... ELISA BrdU Colorimetric assay (Roche) was performed according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The TaqMan primer sequences and associated universal probes were generated using ProbeFinder (version 2.53, Roche). The primers themselves were ordered from IDT ...
-
bioRxiv - Cell Biology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) while mitochondrial metabolism was assessed using the MTT assay ...
-
bioRxiv - Physiology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) as previously described 26.
-
bioRxiv - Cancer Biology 2021Quote: ... Proliferation of cultured cells was measured by assessing BrdU incorporation (Cell proliferation ELISA Kit 11647229001; Roche) after addition of Dox (2µg/ml ...
-
bioRxiv - Immunology 2020Quote: Telomerase activity was assessed with a TeloTAGGG telomerase ELISA kit according to the manufacturer’s instructions (Roche) and extracts of 2 × 103 viable T cells as described previously27.
-
bioRxiv - Molecular Biology 2022Quote: ... DNA fragmentation was evaluated using a Cellular DNA Fragmentation ELISA Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected with mouse (Covance) or rat (Roche) monoclonal anti-V5 antibodies at 1 μg/ml or 12.5 ng/ml respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Immunology 2019Quote: ... RNAseq libraries were prepared as previously described 70 using KAPA Standed RNA-seq library preparation kit (KAPA Biosystems), and sequenced on an Hi-Seq 2500 platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... KAPA Mouse Genotyping Kits (Kapa Biosystems, KK7352) were used to identify genotypes of mice.
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were stained with Bromodeoxyuridine (BrdU) and assessed with a BrdU ELISA kit (Roche, Mississauga, ON, Canada) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Cell Biology 2020Quote: ... BrdU Cell Proliferation ELISA assay (Roche, 11647229001) was used to assess the proliferation of RKO and DLD1 cells according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genomics 2019Quote: ... Amplified genomic DNA (70 ng) was used to generate exome sequence libraries using the Hyper Prep kit (Kapa Biosystems, KK8504), SureSelect Target Enrichment kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Cell Biology 2019Quote: GFP-Pav and Tum proteins were incubated with mouse anti-GFP antibody (Roche) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: BSA Protein Assay Kit (A8020-5, Roche, Basel, Switzerland) was applied to measure the protein concentration after lysing BC cells with RIPA buffer ...