Labshake search
Citations for Roche :
1 - 50 of 5590 citations for Human Mitochondrial Open Reading Frame Of The 12S rRNA c MOTS c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Human TGs were measured using the Cobas c 501 analyzer (Roche Diagnostic). For this purpose ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with anti-DIG-POD antibody (Roche; 1:1000 in TNB; 12 hr, 4 °C), and washed in TNT (3 × 20 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Glu-C (Roche), and chymotrypsin (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Lys-C (Roche), Glu-C (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... Purified parasites treated at 12°C for 1 h with freshly prepared 1 mg/mL pronase (Roche)/0.01% saponin/PBS before washing ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 95°C for 5 min (90°C for 15 sec, 60°C for 60 sec) × 50 cycles (Light/Cycler Nano, Roche). The primer sets used in this study were described in the supplemental Table 1.
-
bioRxiv - Microbiology 2022Quote: ... 95°C), annealing (10 sec, 58°C) and elongation (10 sec, 72°C) performed on a LyghtCycler 96 Instrument (Roche). MIC14 and MIC15 transcripts were amplified with the primer pairs P64/P65 and P66/P67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... C-circle signal was detected using the CDP-Star kit (Roche) according to the manufacturer’s instructions and imaged using the ChemiDoc™ Imaging System (BioRad ...
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2021Quote: ... Anti-c-Myc (Roche) molecules were covalently linked to the carboxylated polystyrene beads (Spherotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Glu-C (Roche) at 25 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Mitomycin C (Merck (Roche), 10107409001) ...
-
bioRxiv - Microbiology 2024Quote: ... mitomycin C (Roche Diagnostics) as prophage-inducing reagent [73] was added in triplicates in different final concentrations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Bioengineering 2019Quote: ... Fluorescence scanning was performed from 25°C- 95°C at a rate of 1°C/min using a Lightcycler 480 Instrument (Roche Life Scientific). Melting temperatures were calculated from the inflection point in the first-derivative curve.
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Developmental Biology 2023Quote: ... dissected in ice-cold PBS and then digested with 4mg/ml Collagenase Type IV/ 0.2mg/ml DNase I /10% FCS/PBS under constant shaking with 700 rpm at 37°C for 12-15 min (Collagenase Type IV, Cat#: 17104-019, Gibco; DNase I, Cat#: 10104159001, Roche). Samples were filtered using a 70µm nylon filter and then washed twice with FACS buffer (0.5% FCS/2mM EDTA in PBS ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were then subsequently digested at 37°C with Lys-C (Roche Applied Science) during 4 h then with trypsin (Sequencing Grade Modified ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001). Anti-FLAG M2 Affinity Gel (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mitomycin C was from Roche (USA). Poly-L-lysine was from Sigma (USA ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-c-myc (9E10 clone, Roche), anti-Flag (M2 ...
-
bioRxiv - Genetics 2019Quote: ... c-myc (Roche, 11667149001; 1:500), HA (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... cv-c riboprobe was marked using DIG RNA Labelling Kit (Roche, 11 175 025 910). Images were taken on an SPE Leica confocal microscope and processed using FIJI and Adobe Photoshop programs.
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 µg poly[d(I-C)] (Roche) competitor DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C) supplemented with protease (Roche, #11697498001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing grade endoproteinase Lys-C (Roche Diagnostics) and modified trypsin (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... c-Myc (Sigma PLA0001 or Roche 11667149001), Histone 3 (Sigma H0164) ...
-
bioRxiv - Pathology 2023Quote: ... α-c-Myc (1:2000, Roche diagnostics), DM1A (1:1000 ...
-
bioRxiv - Genetics 2021Quote: ... Capture-C libraries were made using the Arima HiC kit (Arima Genomics) and the KAPA HyperPrep kit (KAPA Biosystems) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: rRNA-depleted RNAseq libraries were prepared using an RNA HyperPrep Kit (KAPA / Roche). 100 ng of RNA were put into the beginning of the library prep protocol ...
-
bioRxiv - Molecular Biology 2022Quote: rRNA-depleted RNAseq libraries were prepared using an RNA HyperPrep Kit (KAPA / Roche). 100 ng of RNA was input into the procedure and fragmented for 3.5 minutes at 94°C ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 min at 37 °C and digested overnight at 37 °C in 1.5 mg/ml collagenase B solution (Roche). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 minutes at 37°C and digested overnight at 37°C in 1.5 mg/ml collagenase B solution (Roche) under continuous agitation ...
-
bioRxiv - Microbiology 2022Quote: ... The KSHV genome-enriched CHi-C library DNA was eluted and PCR enrichment (12 cycles) performed with high-fidelity KAPA HiFi HotStart DNA Polymerase (Kapa Biosystems, Inc., Wilmington, MA). Libraries were multiplex sequencing (2 × 150 bp ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting Hi-C library was amplified by PCR (KAPA Biosystems HiFi HotStart PCR kit, KK2502), and sequenced by Illumina 50 bp paired-end sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... Hi-C next-generation sequencing (NGS) libraries were prepared using the KAPA HyperPlus Kit (KAPA Biosystems) according to instructions 129.
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture was re-incubated 20 min at 75°C and the purified DNA product further incubated overnight at 16°C with a T4 DNA ligase (Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 30 s at 72°C) and final extension 5 min at 72°C using KAPA Taq DNA polymerase (KAPA BIOSYSTEMS). PCR products were visualized on 2% agarose gels containing SYBR Safe DNA gel stain (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... pursued by 95°C for 3 min and then 45 cycles at 95°C for 15 sec and 58°C for 30 seconds using a LightCycler-480 Real-Time PCR system (Roche). The primers and the probes were designed against the E gene17.
-
bioRxiv - Microbiology 2020Quote: ... followed by 45 cycles of amplification under the following conditions: 94°C for 15 s and 60°C for 60 s in a LightCycler 96 (Roche).
-
bioRxiv - Microbiology 2021Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Microbiology 2023Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-c-myc 9E10 (Roche, 11667203001); mouse monoclonal anti-FLAG M2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal anti–c-myc antibody was from Roche Applied Science (Indianapolis ...