Labshake search
Citations for Roche :
1 - 50 of 4879 citations for Homovanillic Acid HVA CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted using the High Pure Viral Nucleic Acid Kit (Roche) according to the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... or High Pure Viral Nucleic Acid kit (Roche) kits ...
-
bioRxiv - Microbiology 2021Quote: ... samples were enzymatically analyzed using a D-Lactic Acid/L-Lactic Acid Enzymatic Bioanalysis UV-Test kit and a D-Glucose Enzymatic Bioanalysis UV-Test kit (Roche Diagnostics) with a modified manufacturer’s protocol to reduce total sample size to 300 uL ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected with the DIG Nucleic Acid Detection Kit (Roche). Wing imaginal discs were mounted in glycerol and imaged with a Nikon E200 bright-field microscope.
-
bioRxiv - Pathology 2020Quote: ... RNA was extracted with the High Pure Kit Nucleic Acid Kit DNA-RNA (Roche Diagnostics) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from 253 resuspended vaginal swab samples using the MagNA Pure Compact Nucleic Acid Isolation Kit (Roche) [33] ...
-
bioRxiv - Microbiology 2019Quote: Viral nucleic acid was extracted from 200µl of the filtrate using the High Pure viral nucleic acid kit (Roche Diagnostics, USA) following the standard protocol ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... viral DNA was purified from SN (High Pure Viral Nucleic Acid Kit, Roche) and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Viral DNA was extracted by the High Pure Viral Nucleic Acid Kit (Roche) and eluted in 40 μM (μL ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... and free fatty acids in plasma was performed using commercial kits (Biovision, Roche, Cayman). Mouse plasma lipoprotein profiles were established by TNO Biosciences (Leiden ...
-
bioRxiv - Microbiology 2021Quote: RNA from virus was extracted using High Pure Viral Nucleic acid extraction kit (Roche). Using gene specific reverse primers of target genes ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from samples using Magnapure LC total nucleic acid isolation kit (Roche). RNA amplification and quantification were carried out using a 7500 Real-Time PCR System (Applied biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... NEFA were analysed using the Free Fatty Acid Kit (half-micro test) (11383175001, Roche) and TG was measured using an enzymatic assay (DF69A ...
-
bioRxiv - Microbiology 2020Quote: ... or using a manual protocol with the High Pure Viral Nucleic Acid kit (Roche Molecular Systems Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Viral DNA was extracted using the Roche high pure viral nucleic acid kit (Roche, USA) according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 2.5 ml of PB buffer ...
-
bioRxiv - Pathology 2023Quote: ... viral DNA was isolated using the High Pure Viral Nucleic Acid kit (Roche Applied Science). Viral titers in terms of viral genome per milliliter (vg/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Linoleic acid (C18) complexed with fatty acid free BSA (Roche 10775835001). PBS and BSA were used as the vehicle control in experiments containing C8 and C18 respectively ...
-
bioRxiv - Genomics 2020Quote: ... concentrators and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 10X (2.5 ml ...
-
bioRxiv - Microbiology 2019Quote: RNAs were re-extracted from the pig feces using High Pure Viral Nucleic Acid Kit (Roche), and cDNA was synthesized with random primers using SuperScript Ⅲ First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... or the MagNA Pure LC Total Nucleic Acid Isolation Kit (Cat. 03038505001, Roche Diagnostic, Basel, Switzerland) following the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extraction was performed using the MagNA Pure Compact DNA Isolation Kit I (Roche Diagnostics) on the MagNA Pure LC automated extractor ...
-
bioRxiv - Immunology 2020Quote: ... viral RNA was isolated from plasma using a MagNA PureCompact Nucleic Acid Isolation kit (Roche Diagnostics). Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2021Quote: ... After neutralizing the samples with HCl the free fatty acids were assayed using a commercial kit (Roche). Concentrations of cholesterol and acetate were measured using commercial kits supplied by Boehringer Mannheim.
-
bioRxiv - Microbiology 2020Quote: ... GISAID: EPI_ISL_413570) obtained from cell culture using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche). We determined the slope by linear regression in GraphPad Prism and defined the required levels for PCR efficiency (E ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted using the column-based High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 40% isopropanol) and DNA was purified using a High Pure Viral Nucleic Acid kit (Roche Life Science) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Genomics 2019Quote: ... 2015) that uses the tube assemblies from the High Pure Viral Nucleic Acid Large Volume kit (Roche, 05114403001). The intact ossicles were placed in the extraction buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...