Labshake search
Citations for Roche :
1 - 50 of 6596 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Physiology 2019Quote: ... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... BrdU ELISA colorimetric kit was purchased from Roche-Sigma Aldrich (Indianapolis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the CAT ELISA kit (Roche, cat. # 11758241001). The ratios of CAT/βGAL were then analyzed to calculate the relative IRES activity.
-
bioRxiv - Systems Biology 2019Quote: For quantification of CAT expression we used an ELISA based assay (CAT ELISA Kit assay, Roche). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2021Quote: The Telo TAGGG Telomerase PCR ELISA kit (Roche, Basel, Switzerland) was used to detect the telomerase activity of keratinocytes after UV irradiation ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Zoology 2021Quote: ... was determined from the cell lysate using an ELISA kit (Roche) in accordance with the company instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Molecular Biology 2021Quote: Cell proliferation was assessed by Cell Proliferation ELISA BrdU kit (11647229001, Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... BrdU incorporation was measured using BrdU Elisa kit (Roche Diagnostic, Manheim, Germany).
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche) in NTMT pH9.5 solution (100mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, #11383221001, Roche) and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in detection buffer ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Neuroscience 2023Quote: ... #11383213001)/BCIP (5-bromo-4-chloro-3-indolyl phosphate, Roche, #11383221001) color development substrate via AP activity ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate solution (Roche). Images were captured using a BX-50 microscope (Olympus Corp. ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Proliferation was measured using the Cell Proliferation ELISA BrdU kit (Roche Diagnostics GmbH), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptosis was evaluated using the cell death detection ELISA kit (Roche, Basel, Switzerland). HUVEC were trypsinized ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-GCTTGAGGTAGC CCTGTTGTCACC-3’ using KAPA HiFi Hotstart polymerase (Roche:KK2602). This PCR reaction produced a 185 bp wild type band and a 750 bp knockout band in heterozygous animals ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.035 mg/ml 5-bromo-4-chloro-3-indolyphosphatase (Roche). Images were acquired by the Leica MZ10F microscope with the DS-Ri1 camera.
-
bioRxiv - Neuroscience 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate, Roche 11383221001). Larvae were mounted in 100% glycerol under coverslips and bright-field images captured using a Leica DFC500 camera mounted on a Zeiss Axioskop
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; 11383221001, Roche) was performed in alkaline phosphatase reaction buffer [100 mM Tris pH 9.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... BrdU incorporation was determined colorimetrically with the Cell proliferation ELISA kit (Roche, Basilea, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Apoptosis was measured in freshly isolated islets using the Cell Death ELISA kit (Roche) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...