Labshake search
Citations for Roche :
1 - 50 of 1386 citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Cells were transfected with YAP/TAZ luciferase reporter construct along with pRL-CMV-Renilla luciferase control reporter vector by Fugene6 (Roche). Luciferase activity was measured with Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Biophysics 2021Quote: ... pH 7.6 with KOH) containing 5 mg mL−1 (type A, ROCHE). Oocytes were kept at 19 °C in a Barth’s solution (in mM ...
-
bioRxiv - Immunology 2023Quote: ... CMV infection/reactivation was determined by pp65 antigenemia assays prior to 2010 and by CMV qPCR (Roche Diagnostics) from 2010 onward.
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The viral particles were produced using ExtremeGene HP (Roche) and 293FT packaging cells using a 3rd generation lentivector packaging system (3 vector system) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Seminiferous tubules retained on the filter were collected and incubated at 32 °C for 25 min in GBSS containing 1.2 mg/mL of Collagenase Type I and 5 μg/mL DNase (Roche 11284932). Cell aggregates were sheared gently by 10 rounds of pipetting with a wide orifice plastic transfer pipet and filtered through the Cell strainer to remove cell clumps ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Genetics 2024Quote: ... and lentiviral envelope vector CMV VSV-G using XtremeGene 9 transfection reagent (Roche). Viral particles were collected 48h after transfection and passed through a 0.45 μm filter to eliminate cells and cell debris ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Physiology 2023Quote: ... Tissue was enzymatically digested using 0.3 mg/ml collagenase (Type II, Worthington or Type A, Roche) and 1.25 mg/ml pancreatin from porcine pancreas (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... Collagenase type I was from Roche laboratory (Madrid ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 U/mL dispase type I (Roche), 10 μM Y-27632 (OrganRegen ...
-
bioRxiv - Immunology 2023Quote: ... 1 mg/ml DNase type I (Roche), 100 ng/ml Dispase (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and type I collagenase (100mg/mL, Roche #11088882001) in PBS 10% FBS (Gibco #A4766801 ...
-
bioRxiv - Cell Biology 2020Quote: ... CMV-GFP-LC3 stable HeLa cell line was cultured as described above with G418 (0.1 mg/ml, Roche). PC12 (rat pheochromocytoma ...
-
bioRxiv - Cell Biology 2019Quote: ... Assays were performed using the Luciferase Reporter Gene Assay Kit (Roche) to obtain data as relative light units (RLU) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Luciferase Reporter Gene Assay according to manufacturer’s instructions (Roche). Hep3B cells were stimulated with human IL-6 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 mg·ml-1 Type-D Collagenase (Roche, Cat# 11088858001) at 100 rpm for 15 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... and 100 μg/ml of DNase type I (Roche). Lung homogenates were next resuspended in PBS and filtered onto a 100-µm cell strainer (Dutscher) ...
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: -Rat Collagen: Type I rat tail Collagen (Roche, Manheim, Germany) was dissolved in 0.2% acetic acid to a final concentration of 3 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 0.3% collagenase type I (Roche Diagnostics, Basel, Switzerland) for 90 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... sgRNA expressing vector along with lentiviral packaging vectors Delta-VPR and CMV VSV-G were transfected into HEK-293T cells using the XTremeGene 9 transfection reagent (Roche). Similarly ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors expressing sgRNAs were transfected into HEK293T cells with lentiviral packaging vectors CMV VSV-G and psPAX2 using XtremeGene 9 transfection reagent (Roche). After 24 h ...
-
bioRxiv - Microbiology 2019Quote: ... The SIV3vpx particles were quantified after thawing using a reverse transcriptase (RT) assay colorimetric kit (Roche) following the manufacturer’s instructions to provide a RT ng/mL titre.
-
bioRxiv - Neuroscience 2023Quote: ... together with Renilla-TK luciferase vector using X-tremeGENE 9 transfection reagent (Roche). The Atp6v1h promoters were cloned into pGL3 plasmid (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... an equal volume of luciferase reagent (ATP Bioluminescence Assay Kit HS II, Roche) was added to each supernatant ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA- or cDNA-expressing vectors and lentiviral packaging vectors Delta-VPR and CMV VSV-G were transfected into HEK293T cells using XTremeGene 9 transfection reagent (Roche #636478700). The supernatant containing virus was collected 48 h after transfection and passed through a 0.45-µm filter ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... The numbers of DNA-containing viral particles was measured using the SYBR Green I Master Kit (Roche) and a LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Zoology 2023Quote: Automated nucleic acid extraction from samples was performed using Magnetic Particle Processors (MagMax, KingFisher, Roche and others) and appropriate kits ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 20 µg mL-1 luciferase reagent (ATP Bioluminescence Assay Kit CLS-II, Roche). The reaction was initiated with 200 µM NADH ...
-
bioRxiv - Cell Biology 2021Quote: The plasmids FUG-T2A-GFP-Cre and control GFP were purchased from Addgene #66691 and lentiviral particles were produced in HEK-293T cells using X-tremeGene 9 DNA Transfection Reagent (Roche). Upon ultracentrifugation concentrated virus particles were stored at −80°C and used to infect pancreatic ductal organoid cultures as previously described (Huch et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We incubated 5μl of clarified crude lysates containing rAAV particles with 50 units (U) of DNAse I (Roche) for 15hr at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... The oocytes were digested with type I collagenase (1.5 mg/mL, Roche) in OR-2 ...
-
bioRxiv - Genomics 2020Quote: ... 400 ng/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany) in L15 medium (Gibco)] and carefully cut into small pieces ...
-
bioRxiv - Genomics 2020Quote: ... 40 μg/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany)) samples were incubated for 15-20 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... Both types of lysis buffer were supplemented with phosSTOP (Roche, catalog # 4906837001) and cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: The experiments in all cell types were performed with Fugene HD (Roche) transfection reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... as the internal reference plasmid were co-transfected with the P65 and P50 expression vector pAd5 E1-CMV-P65/P50 (each 300 ng) or the control vector pAd5 E1-CMV-MCS (600 ng) into the cells using X-tremeGENE HP Reagent (Roche, Indianapolis, IN, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... using a luciferase based bioluminescence assay (ATP Bioluminescence Assay Kit HS II, Roche Applied Science). 3 thoraces were used for one assay and 3∼4 assays were performed for each genotype.
-
bioRxiv - Epidemiology 2019Quote: ... and C-reactive protein (CRP) was measured by automated particle-enhanced immunoturbidimetric assay (Roche UK, Welwyn Garden City, UK). CRP levels were measured at nine ...
-
bioRxiv - Microbiology 2021Quote: The AAV2 stock sample (1.5*1011 genome-containing particles) was pre-treated with 10U DNase I (04716728001, Roche, Switzerland) in 1x DNase buffer for 15 min at 37°C to remove any DNA outside the particles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2% Tergitol type NP40) supplemented with complete EDTA-free protease inhibitor cocktail (Roche), 5 mM sodium fluoride and 10 mM β-glycerophosphate ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2% Tergitol type NP40) supplemented with complete EDTA-free protease inhibitor cocktail (Roche), 5 mM sodium fluoride and 10 mM β-glycerophosphate ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2% Tergitol type NP40) supplemented with complete EDTA-free protease inhibitor cocktail (Roche), 5 mM sodium fluoride and 10 mM β-glycerophosphate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each slice was embedded into 10 μl of rat type I collagen (Roche Diagnosis ...