Labshake search
Citations for Roche :
1 - 50 of 5730 citations for 7 Phenyl 1 heptanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... testis albuginea was peeled and added in RIPA buffer supplemented with 1mM phenyl methyl sulfonyl fluoride (PMSF) and PIC (Roche Diagnostics, 04693132001), the solution was sonicated transiently and then on the ice for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 mM β-mercaptoethanol and protease inhibitor cocktail (Roche complete ...
-
bioRxiv - Molecular Biology 2022Quote: ... a mix of 7 μl of proteinase K (Roche), 1 μl of glycogen (Sigma G1767-1VL ...
-
bioRxiv - Immunology 2021Quote: ... hydrocortisone hemisuccinate (7×10−5 M, Roche-Boehringer-Manheim) and FCS (10% selected ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfected HEK29T cells and COS-7 cells were washed and lysed with 1% Triton X-100 in PBS with protease inhibitor cocktail (Roche) at 4 °C for 1 hr ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell pellets were homogenized in lysis buffer (7 M urea, 2 M thiourea, 1% CHAPS, 70 mM DTT, and Roche EDTA-free complete protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Molecular Biology 2023Quote: ... The frozen cell pellets were resuspended in lysis buffer (50 mM TRIS pH 7, 150 mM NaCl, 1 mM EDTA, Roche’s complete Protease inhibitors ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were resuspended in lysis buffer (100 mM Pi pH 7, 100 mM NaCl, 1 mM DTT, C0mplete protease inhibitor tablet, Roche) and lysed by sonication for 8 min (Vibracell ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Physiology 2021Quote: ... containing cOmplete EDTA-free protease inhibitor cocktail at a concentration of 1 tablet/7 ml (Roche Applied Science, Indianapolis, IN, USA)) by repeated passage through a 20-gauge needle to obtain plasma membrane-enriched preparations ...
-
bioRxiv - Microbiology 2023Quote: ... one half was immunoblotted with NB13 (7 µg/mL) followed by washing and probing with α-HA-peroxidase (1:1000, Roche), whereas the other half was probed with α-His-peroxidase only (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were lysed in 1% Triton X-100 (20 mM Tris [pH 7], 150 mM NaCl, 5 mM MgCl2) containing protease inhibitor (Roche, Cat# 11697498001) with end-over-end rotation for 20 min at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Biochemistry 2021Quote: Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellet was resuspended in 7 mL of buffer (50 mM Hepes pH 7.4, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and subjected to 20 strokes in Dounce homogenizer ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellet was resuspended in 7 mL of buffer (50 mM Hepes pH 7.4, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and subjected to 20 strokes in Dounce homogenizer ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Genomics 2020Quote: ... Day 4 (HH21-24) and day 7 (HH30-31) ventricular samples were digested in 1.5mg/mL collagenase type II/ dispase (Roche) for one cycle of 20 minutes and one cycle of 10 minutes under mild agitation at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Genomics 2020Quote: ... Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems). Single-end 100 bp sequencing was performed on a HiSeq 1500 or a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were homogenized by sonication in PBS (pH=7) mixed with a protease inhibitor cocktail (Complete®, Roche, Spain). After adjusting protein levels ...