Labshake search
Citations for Roche :
1 - 50 of 75 citations for 7 OCTENENITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 mM β-mercaptoethanol and protease inhibitor cocktail (Roche complete ...
-
bioRxiv - Molecular Biology 2022Quote: ... a mix of 7 μl of proteinase K (Roche), 1 μl of glycogen (Sigma G1767-1VL ...
-
bioRxiv - Immunology 2021Quote: ... hydrocortisone hemisuccinate (7×10−5 M, Roche-Boehringer-Manheim) and FCS (10% selected ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Genomics 2020Quote: ... Day 4 (HH21-24) and day 7 (HH30-31) ventricular samples were digested in 1.5mg/mL collagenase type II/ dispase (Roche) for one cycle of 20 minutes and one cycle of 10 minutes under mild agitation at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Genomics 2020Quote: ... Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems). Single-end 100 bp sequencing was performed on a HiSeq 1500 or a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were homogenized by sonication in PBS (pH=7) mixed with a protease inhibitor cocktail (Complete®, Roche, Spain). After adjusting protein levels ...
-
bioRxiv - Immunology 2022Quote: ... was added and cells were centrifuged at 350g for 7 min at 4°C and resuspended in PBS with 0.5% BSA (Roche) and 1% FBS (Sorting Buffer) ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR analysis was performed using primers detailed in Supplementary file 7 on a Roche Lightcycler 480 II (Roche Holding AG) using LightCycler 480 SYBR Green I Master mix (Roche Holding AG ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The resulting 1,055 samples of differentiated EBs were lysed after 7 days in 350 μl MagNA Pure LC RNA Buffer (Roche Diagnostics) and purified using an automated MagNA Pure 96 system (Roche Diagnostics) ...
-
bioRxiv - Genomics 2019Quote: ... An additional Proteinase K incubation (65 μl of 10mg/mL per 7 million cells starting material) at 65°C for two hours was followed by RNase A (Roche; 15 μl of 10mg/mL per 7 million cells starting material ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.7 µM of total delta-Phe aa-tRNA (total tRNA charged with all amino-acids except Phe; tRNA from Roche) and 100 nM of EF-G were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfected HEK29T cells and COS-7 cells were washed and lysed with 1% Triton X-100 in PBS with protease inhibitor cocktail (Roche) at 4 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA samples with a RIN of at least 7 were used to generate libraries by GTAC using the RNA zero kit (Roche). Samples were prepared according to library kit manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Biochemistry 2022Quote: Pellets were resuspended in buffer A (20 mM Tris pH 7, 500 mM KCl) supplemented with EDTA-free complete protease inhibitor (Roche) and 250 μg/mL of lysozyme ...
-
bioRxiv - Biochemistry 2022Quote: ... or octamer-mix were done at 900 MHz 1H Larmor frequency at 298 K in NMR buffer (25 mM NaPi, pH 7, 5% D2O, with 1x protease inhibitors (complete EDTA-free cocktail, Roche)) with 600 mM NaCl for the titrations with H2A-H2B and H3-H4 and 300 mM NaCl for titration with octamer-mix ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell pellets were homogenized in lysis buffer (7 M urea, 2 M thiourea, 1% CHAPS, 70 mM DTT, and Roche EDTA-free complete protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 50 ml lysis buffer (Hepes 20 mM pH 7, 150 mM NaCl, benzonase, EDTA-free protease inhibitor cocktails (ROCHE)) at 4°C and lysed by sonication ...