Labshake search
Citations for Roche :
1 - 50 of 1488 citations for 7 Benzothiazolol 2 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2021Quote: Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 100 µl of Tetra-Methyl Benzidine (TMB, Roche, Germany) solution was added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell pellets were homogenized in lysis buffer (7 M urea, 2 M thiourea, 1% CHAPS, 70 mM DTT, and Roche EDTA-free complete protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Immunology 2021Quote: We used DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate) (Roche) to introduce LPS or oxPLs into cells following the method by Zanoni et al (Zanoni et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were arrested at metaphase by incubating with colcemid (N-methyl-N-deacetyl-colchicine, Roche, 10295892001) for the last 14 hours before harvesting the cells ...
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 mM β-mercaptoethanol and protease inhibitor cocktail (Roche complete ...
-
bioRxiv - Molecular Biology 2022Quote: ... a mix of 7 μl of proteinase K (Roche), 1 μl of glycogen (Sigma G1767-1VL ...
-
bioRxiv - Immunology 2021Quote: ... hydrocortisone hemisuccinate (7×10−5 M, Roche-Boehringer-Manheim) and FCS (10% selected ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: LC-MS-based quantification of methyl-cytosines was performed on 1 μg of DNA degraded to nucleosides with nuclease P1 (Roche), snake venom phosphodiesterase (Worthington ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... testis albuginea was peeled and added in RIPA buffer supplemented with 1mM phenyl methyl sulfonyl fluoride (PMSF) and PIC (Roche Diagnostics, 04693132001), the solution was sonicated transiently and then on the ice for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... Cationic lipid N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (Dotap, Liposomal Transfection Reagent, Cat#1202375, Roche, Nonnenwald, Penzberg, Germany) was used for the conjugation of phosphorothioated miRNAs and Dotap-formulated miRNAs were used for in vitro delivery of miRNAs ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Physiology 2023Quote: ... the slides were placed in the terminal dUTP-nick-end labelling (TUNEL) solution (labelling with either fluorescein or tetra-methyl-rhodamine; Roche Diagnostics GmbH, Mannheim, Germany) in 37°C for 1 h and covered in Vectashield with DAPI (Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100, 10 mM N-methyl maleimide (general DUB inhibitor diluted in DMSO, freshly added) and protease inhibitors (Roche Diagnostics, EDTA-free, freshly added). Then ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...