Labshake search
Citations for Roche :
1 - 50 of 179 citations for 7 12 Dimethylbenz a ant racene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time PCR assay targeting the virus of interest (see primers/probe sets in Table 7) was performed in a final volume of 12 µL using the LightCycler® 480 Probe Master Mix 1X (Roche Applied Science, Germany), with primers and probes at 200 nM and 2 µL of control DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Developmental Biology 2023Quote: ... or fluorescein-12-UTP (Roche) using standard molecular protocols (Collins et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... fluorescein-12-UTP (FITC, Roche Diagnostics), or digoxigenin-11-UTP (DIG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 mM β-mercaptoethanol and protease inhibitor cocktail (Roche complete ...
-
bioRxiv - Molecular Biology 2022Quote: ... a mix of 7 μl of proteinase K (Roche), 1 μl of glycogen (Sigma G1767-1VL ...
-
bioRxiv - Immunology 2021Quote: ... hydrocortisone hemisuccinate (7×10−5 M, Roche-Boehringer-Manheim) and FCS (10% selected ...
-
bioRxiv - Genetics 2021Quote: ... 12 U/mL Dispase II (Roche, 39307800) and 0.5mM CaCl2 ...
-
bioRxiv - Biochemistry 2019Quote: ... or 12 ng/μl of chymotrypsin (Roche) in 25 mM NH4CO2 overnight at 25 °C ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... (2 mg/kg; atezolizumab, Roche; n = 12). Group 3 received anti-TGF-β I.P ...
-
bioRxiv - Genetics 2021Quote: ... 12 U/ml Dispase II (04942078001, Roche) and 0.5 mM CaCl2 in Ham’s F10 media (11550043 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... 12 unit/mL MDH (from pig heart; Roche Diagnostics ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Fluorescein-12-UTP-labeled (Sigma/Roche 11427857910) riboprobes (1 ng/μl ...
-
bioRxiv - Plant Biology 2024Quote: ... or Fluorescein-12-UTP (Roche, Cat No: 11373242910) was prepared (Additional file1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 12 min and Bluing reagent (Roche, 760-2037) for 4 min as a post-counterstain procedure ...
-
bioRxiv - Molecular Biology 2022Quote: ... 12 μL X-tremeGENE 9 DNA Transfection Reagent (Roche) and 500 μL Opti-MEM (Gibco ...
-
bioRxiv - Plant Biology 2020Quote: ... 12 µl of complete His-Tag Purification Resin (Roche) was added and incubated for 15 min at 25°C ...
-
bioRxiv - Genetics 2021Quote: ... rDNA was labelled with Fluorescein-12-dUTP (ROCHE Diagnostics) using the nick translation method.
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Plant Biology 2020Quote: ... 12 unit/ml MDH (from pig heart; Roche Diagnostics, Basel) and 4 mM PEP ...
-
bioRxiv - Cell Biology 2021Quote: ... rat monoclonal anti-HA-HRP (Roche, 12 013 819 001), mouse monoclonal anti-beta-Actin-HRP (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... or HA-HRP antibody (12-013-819; 1:3,500; Roche). The antigen-antibody complexes were visualized using appropriate HRP conjugated secondary antibodies and enhanced chemiluminescence kit (ECL ...
-
bioRxiv - Developmental Biology 2020Quote: ... TMR red was used (Roche, cat# 12 156 792 910) and manufacturer’s protocol was followed ...
-
bioRxiv - Cell Biology 2023Quote: ... 12 μg of mouse monoclonal anti-GFP antibodies (11814460001; Roche) preconjugated with 60 μl slurry of Protein-G magnetic beads (10004D ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 μg of mouse monoclonal anti-GFP antibodies (11814460001; Roche) preconjugated with 60 μl slurry of Protein-G magnetic beads (10004D ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Developmental Biology 2019Quote: ... Section permeability was improved using 12 μg/mL Proteinase-K (Roche) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Genetics 2019Quote: ... after a 12-plex enrichment with SeqCap EZ MedExome kit (Roche, Basel, Switzerland), according to manufacturer’s specifications ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µl KAPA HiFi HotStart ReadyMix (F. Hoffmann-La Roche AG, Basel, Switzerland), 2.5 µl 2 µM (bacterial and fungal ...
-
bioRxiv - Molecular Biology 2023Quote: ... Post-capture PCR (12 cycles) was performed using KAPA HiFi Hotstart ReadyMix (Roche) and xGen Library Amplification Primer Mix (IDT) ...
-
bioRxiv - Bioengineering 2023Quote: ... 12 and 14 were analyzed using a Cedex Bio Analyzer (Roche, Basel, Switzerland) to monitor glucose ...