Labshake search
Citations for Roche :
1 - 50 of 8295 citations for 7 Chloromethyl 5H 1 3 thiazolo 3 2 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche) in NTMT pH9.5 solution (100mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, #11383221001, Roche) and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in detection buffer ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Neuroscience 2023Quote: ... #11383213001)/BCIP (5-bromo-4-chloro-3-indolyl phosphate, Roche, #11383221001) color development substrate via AP activity ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate solution (Roche). Images were captured using a BX-50 microscope (Olympus Corp. ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-GCTTGAGGTAGC CCTGTTGTCACC-3’ using KAPA HiFi Hotstart polymerase (Roche:KK2602). This PCR reaction produced a 185 bp wild type band and a 750 bp knockout band in heterozygous animals ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.035 mg/ml 5-bromo-4-chloro-3-indolyphosphatase (Roche). Images were acquired by the Leica MZ10F microscope with the DS-Ri1 camera.
-
bioRxiv - Neuroscience 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate, Roche 11383221001). Larvae were mounted in 100% glycerol under coverslips and bright-field images captured using a Leica DFC500 camera mounted on a Zeiss Axioskop
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; 11383221001, Roche) was performed in alkaline phosphatase reaction buffer [100 mM Tris pH 9.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Genomics 2020Quote: ... Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) were used for the colorimetric detection of alkaline phosphatase activity ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5-bromo-4-chloro-3’-indolyphosphate (NBT/BCIP) and FastRed (Roche, Germany) staining was performed according to established published protocols62,63 using the following DIG and FITC labeled probes:
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...