Labshake search
Citations for Roche :
1 - 50 of 8191 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 and 6 post transfection using WST-1 dye (Roche, Basel, Switzerland) as previously described 17.
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pancreas was minced into 2- to 3-mm pieces and digested with 0.2 mg/ml collagenase P (Roche) at 37 °C for 10-12 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, Mannheim, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Drug cytotoxicity was evaluated by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Cell Proliferation Kit I, Roche) with a NanoQuant microplate reader (Tecan Trading AG ...
-
bioRxiv - Microbiology 2021Quote: The cytotoxicity assays were performed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Roche, ref:11465007001) protocols according to the previous study [47] with few modifications ...
-
bioRxiv - Biochemistry 2024Quote: Cell metabolic viability was measured by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Roche). After treatments ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).