Labshake search
Citations for Roche :
3501 - 3550 of 9048 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... the pelleted cells were re-suspended in 10 mM Tris pH 7.6 buffer containing cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Sciences, Penzberg, Germany), sonicated ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Neuroscience 2022Quote: ... The supernatant was aspirated and the pellet was resuspended in a pre-warmed digestion mix containing 1 mg ml-1collagenase/dispase (Roche Diagnostics, Indianapolis, USA) and 10 μg ml-1DNase I (Roche Diagnostics ...
-
bioRxiv - Genomics 2024Quote: ... the tissue fragments were transferred into a Douncer homogenizer containing a protease inhibitor cocktail (PIC, Roche, 1 tablet in 50 ml of PBS) solution immersed in ice and homogenized using pestles A and B (from less to more plunger adjustment) ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Immunology 2023Quote: ... a left lobe was digested for 1 hour at 37°C in RPMI containing 13 mg/mL DNase I (Roche, Randburg, South Africa) and 50 U/mL collagenase IV (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... and the cell pellet was re-suspended in 2 ml of triturating solution (containing 10 mg/ml bovine serum albumin [A7906, Sigma], 0.5 mg/ml trypsin inhibitor [10109886001, Roche], 0.02 mg/ml deoxyribonuclease).
-
bioRxiv - Cell Biology 2020Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Cell Biology 2019Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Immunology 2019Quote: ... The protein was produced by transient transfection of HEK 293T cells with XtremeGene™ HP Transfection reagent (Roche) according to the manufacturer’s instructions and purified following a published protocol (77) ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to PVDF membranes and labelled overnight with anti-HA (0.01 μg/mL, Roche clone 3F10), anti-VE-Cadherin (0.5 μg.ml−1 ...
-
bioRxiv - Biochemistry 2019Quote: Overall protein was extracted through RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) with protease inhibitors (Roche, Basel, Switzerland), and then quantified through BCA™ Protein Assay Kit (Pierce ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
Individual differences in honey bee behavior enabled by plasticity in brain gene regulatory networksbioRxiv - Genomics 2020Quote: ... with protein inhibitor complex (PIC, Complete Tablets, EDTA-free Protease Inhibitor Cocktail from Roche, Basel, Switzerland, cat. #04693132001) using a motorized pestle for 20 seconds ...
-
bioRxiv - Microbiology 2021Quote: ... Equivalent amounts of protein samples were separated by SDS-PAGE and electroblotted onto a polyvinylidene fluoride membrane (Roche) using a Mini Trans-Blot Cell (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... shTDP-43 HEK293E cell pellets from confluent 10cm plates were washed twice in ice-cold PBS and then resuspended in 500μl of hypotonic buffer A (10mM HEPES, 1.5mM MgCl2, 10mM KCl, 0.1mM DTT and protein inhibitor cocktail (Roche) and incubated on ice for 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The total protein pellets were resuspended in 1 mL NP-40 with protease inhibitor cocktail (Roche Diagnostics GmbH). Samples were pre-cleared using Protein A/G plus agarose beads (Pierce ...
-
bioRxiv - Plant Biology 2019Quote: ... The presence of the proteins of interest was tested by immunodetection using rat anti-HA-peroxidase (3F10, Roche) or chicken anti-c-Myc primary antibody (A2128 ...
-
bioRxiv - Cancer Biology 2019Quote: All A673/TR/shEF in vitro and xenograft proteins were extracted with RIPA and anti-protease cocktail (Roche). Western blots were hybridized with rabbit monoclonal anti-FLI1 antibody (1:1000 ...
-
bioRxiv - Immunology 2020Quote: ... The TM protein was produced by transient transfection of HEK 293T cells with XtremeGene HP Transfection reagent (Roche) according to the manufacturer’s instructions and purified following a published protocol (48) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified from filtered cell supernatants using StrepTactin resin (IBA) or cOmplete His-Tag Purification Resin (Roche) or Jacalin (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: After being pre-cleared with protein A/G-coupled Sepharose beads (Cat. 11134515001 and 11243233001, Roche, Mannheim, Germany) for 2 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... Separated proteins were transferred to PVDF membranes (GE Water & Process Technologies) and treated with Western blocking reagent (Roche) for overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... The protein was produced by transient transfection of HEK 293T cells with X-tremeGENE HP Transfection Reagent (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibodies were used to detect green fluorescent protein (GFP) (Cat#11814460001, clones 7.1 and 13.1, Roche). Rabbit polyclonal anti-Cdc42p antibodies were provided by Dr ...
-
bioRxiv - Immunology 2022Quote: Protein extraction was performed using RIPA buffer in the presence of complete Mini EDTA-free protease inhibitor (Roche) and PhosSTOPTM phosphatase inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal quantities of protein were electrophoresed on 10% SDS-PAGE and transferred onto a nitrocellulose membrane (Roche Diagnostics). The membranes were incubated with the primary antibody overnight at 4°C after blocking with 5% milk dissolved in TBST buffer for another 2 h at room temperature (25°C) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the frozen brain samples were homogenized in tissue protein extraction reagent (Pierce) supplemented with complete protease inhibitors (Roche), and centrifuged for 1 hour at 430 000 g at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Pathology 2024Quote: Cholesterol and triglyceride levels were quantified in liver protein lysates and EDTA-plasma using enzymatic colorimetric assays (c.f.a.s. cobas, Roche Diagnostics) according to the manufacturer’s protocol ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: For immunoblot analysis of proteins, tissues were homogenized in RIPA buffer (R0278, Thermo) with proteinase inhibitors (11836170001, Roche) and phosphatase inhibitors (04906837001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two days after transfection cells were washed twice with ice-cold PBS and scraped in ice-cold Co-IP buffer (10 mM Tris/Cl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, protein inhibitor cocktail (Roche)) supplemented with 0.5% Nonident P40 ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads suspension (Roche, cat. # 11719416001) for 3 h at 4°C on a mini-rotator ...
-
bioRxiv - Cancer Biology 2023Quote: ... The His-tagged-TRF2TRFH protein was purified in presence of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) by using Protino ® Ni-TED 2000 Packed Columns (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2024Quote: ... protein samples were subjected to 10% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Roche, Mannheim, Germany). Afterwards ...
-
bioRxiv - Cell Biology 2024Quote: Cell protein was extracted on ice in cold whole-cell RIPA buffer supplemented with protease inhibitor cocktail (Roche). SDS-PAGE was performed using 10% Tris-glycine gels ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: Cell lines: Cells were lysed with RIPA buffer and prepared for total protein extraction with protease inhibitors (Roche). After 20 minutes of centrifugation (>16000g) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM PMSF and 1 tablet/80 ml of complete EDTA-free protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in ice-cold FACS buffer (2% FBS, (0.5 ug/ml) DNase I (Roche), 2 mM EDTA in PBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library amplification and indexing were performed with KAPA HiFi HotStart Uracil+ ReadyMix (2×) (Kapa Biosystems KK2801). The PCR amplification was carried out as follows ...
-
bioRxiv - Genomics 2019Quote: ... The remaining fragments were then treated with a collagenase/dispase mixture (2 mg/mL final) (Roche) and DNase I (2 mg/mL final ...
-
bioRxiv - Genomics 2020Quote: ... contaminating genomic DNA was removed by incubating with 2 µl of RNase-free DNase I (Roche) for 30 min at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... with both basic (Cell Conditioner 1) and mildly acidic (Cell Conditioner 2) antigen retrieval methods (Roche, Ventana Medical Systems ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of sample was mixed with 10 µL 2X SYBR Mix (Kapa Biosystems, Wilmington, MA), 0.4 µL of each 10 µM primer (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... spanning the SARS-CoV-2 genome) were purified using Kapa HyperPure beads (Roche Molecular Systems Inc) and quantified using a Qubit fluorometer and dsDNA HS Assay Kit (Thermo Fisher Inc ...
-
bioRxiv - Pathology 2021Quote: ... Lymph node samples then had 2 µl of 500 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Microbiology 2021Quote: ... DS6350 chromosomal DNA was used as a template and Expand polymerase with Expand Buffer 2 (Roche). The resulting PCR fragment was purified using the QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... but tested negative on the day of sampling (cobas® SARS-CoV-2 test, Roche diagnostics), and from a healthy individual ...