Labshake search
Citations for Roche :
301 - 350 of 10000+ citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... anti-HA (Rat, #11867423001 Sigma Roche), anti-Dan (Rabbit ...
-
bioRxiv - Genetics 2024Quote: ... rat anti-HA (Clone 3F10, Roche) at 1:50 ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Genomics 2023Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-HA tag (Roche, 11867432001), rabbit anti-FAM134B (Sigma Prestige ...
-
bioRxiv - Microbiology 2024Quote: ... rat monoclonal anti-HA antibody (Roche);) ...
-
bioRxiv - Microbiology 2024Quote: ... rat α-HA (3F10; Roche Diagnostics) 1:2 500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blots were re-probed using rat anti-HA (clone 3F10, Roche cat #11867423001; 1:10,000 dilution) to detect ZMPSTE24 and visualized using goat anti-rat IRDye 680RD.
-
bioRxiv - Cancer Biology 2021Quote: ... Western blots were performed by standard methods using rat anti-HA (1:1000; clone 3F10, ROCHE), rabbit anti-GFP (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used in this study were: rat anti-HA (1:250; Roche 3F10, RRID: AB_2314622), rabbit anti-cleaved Caspase-3 (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Developmental Biology 2022Quote: The following primary antibodies were used in this study: anti-HA (rat, 1:200, 11867423001, Roche), anti-V5 (mouse ...
-
bioRxiv - Microbiology 2019Quote: ... PfAP2-G and PfAP2-I were detected with 1 μg/mL rat α HA (Roche 3F10) and 2 μg/mL rabbit α GFP (Abcam ab290) ...
-
bioRxiv - Genomics 2022Quote: Commercially available or published antibodies used for western blotting: rat anti- HA (1:2000, Roche 11867423001) (Figure 9A,B) ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibodies used (at 1/1,000, unless specified) were rat anti-HA tag (clone 3F10, Roche), mouse anti-TY tag (27) ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti HA (1:500, Roche, #11-867-423-001), chicken anti GFP (1:800 ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibodies dilutions were as follow: high affinity rat anti-HA (clone 3F10, Roche; 1:1,000), mouse anti-FIKK4.2 (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: Antibody staining of fixed germlines was performed with 1:500 Rat anti-HA 3F10 (Roche 11867423001), 1:500 Rabbit anti-GFP (Thermo A-11122) ...
-
bioRxiv - Bioengineering 2023Quote: ... We also switched from mouse anti-HA to rat anti-HA (Roche catalog #3F10, 1:1000) to circumvent antibody cross reactivity issues observed with Olig2 and other cell type markers ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies used for immunostaining included anti-HA (1:500, ROHAHA rat polyclonal, clone 3F10, Roche) and anti-GFP (1:2000 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was measured by determining the extent of 5-Bromo-2’-deoxy-uridine (BrdU) incorporation into DNA of U87-MG cells using the BrdU cell proliferation assay ELISA kit (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Differentially expressed transcripts were analyzed with SYBR Green Mix (Roche FastStart Universal SYBR Green Master) and specific primers (Supplementary Table S2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B phosphotranferase (HYG) or blastacidin S deamidase gene (BSD) generated using the PCR DIG Probe Synthesis Kit (Roche). The blot was developed according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... genes of SARS-CoV-2 was performed using the LightMix Modular SARS and Wuhan CoV E-gene Kit (TIB MOBIOL, Synheselabor GmbH, Berlin, Germany) in a LightCycler 480 II system following the manufacturer’s recommendation (Roche Diagnostics International Ltd. ...
-
bioRxiv - Bioengineering 2023Quote: ... of the VH gene was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene-specific primers (primer No. 23–32, 7.5 μl) and a KAPA Biosystems kit (Roche). The reaction conditions were as follows ...
-
bioRxiv - Physiology 2020Quote: ... The expression of all genes was related to an internal housekeeping gene assay for Actb (Roche, Welwyn, UK) as described previously (O’Hara et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat pups were injected with BrdU (i.p. 50 mg kg-1 day-1 BrdU in saline; Roche Diagnostics, Indianapolis, IN, USA) for 5 consecutive days ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum ACT1 (final dilution 1:500; a kind gift from Jake Baum) or rat anti-HA (1:1000; Roche, Basel, Switzerland) for HA-tagged GAP45 and AMA1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... DF-1 cells were transfected with the relevant RCAS viral plasmids using Extreme-Gene 9Transfection reagent (Roche) accordingly to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1/10 volume of Protein-G agarose beads (Roche) was then added and the sample rotated for 30 min at RT °C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: The rat pancreas was isolated following injection of 1 mg/mL collagenase P (Roche, Indianapolis, IN, USA) through the common bile duct ...
-
bioRxiv - Neuroscience 2021Quote: ... The following antibody cocktails were used: rat anti-HA (1:200, Cat. No. 10145700, Roche Diagnostics, USA) with rabbit anti-CamKIIα (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Cell Biology 2024Quote: ... primary antibody incubation was performed in blocking buffer with anti-HA-tag (rat, Roche, 11867423001, 1:250) or anti-CD9 (mouse ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was probed using the primary antibodies mAb rat α-HA (1:2,000, Roche Diagnostics #11867423001) or mAb mouse α-PfGAPDH (1:20,000 ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were then incubated for 1 h at 4° C in PBS + 1% BSA with a 1:1000 dilution of rat anti-HA monoclonal antibody (Roche; Basel, Switzerland) and washed 5×10 min on ice with PBS + 1% BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... Coronal sections containing the medial prefrontal cortex (mPFC) or hippocampus were incubated with (1) an antibody cocktail of rat anti-HA (1:200, Cat. No. 10145700, Roche Diagnostics, USA) with rabbit anti-PV (1:500 ...
-
bioRxiv - Biophysics 2019Quote: Rat ventricular myocytes were isolated from adult Sprague-Dawley rats (200 – 250 g) by enzymatic (Liberase™, Roche) digestion (Colecraft et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Gene transcription was quantified by qPCR using a LightCycler 480 SYBR Green I Master kit and LightCycler 480 (Roche, Switzerland). The PCR conditions were 95 °C for 10 min followed by 45 cycles of 95 °C for 10 s ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR analysis of cytokine related porcine gene expression was performed using the KAPA SYBR-FAST qPCR Kit (KAPA Biosystems), using the primers shown in Table 1 ...
-
bioRxiv - Genetics 2021Quote: We extracted DNA from nail samples using the ISOHAIR (Nippon Gene) and oral mucosa samples using the High Pure PCR Template Preparation Kit (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... Gene expression was detected using the LightCycler 480 SYBR Green I Master Mix or Probes Master Mix kit (Roche Diagnostics) after PCR (5 min at 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... A dioxigenin (DIG)-11-UTP-labeled antisense riboprobe targeting the gene transcript of interest was synthesized using the DIG labelling kit (Roche) and T7 RNA polymerase80 ...