Labshake search
Citations for Roche :
3351 - 3400 of 9048 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: The pooled samples were transferred to MagNA Lyser Green Beads containing tubes and homogenized using a MagNA Lyser instrument (Roche, Basel, Switzerland). Total RNA was subsequently extracted from the tissue homogenate with the RNeasy Lipid Tissue Kit (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... Microwave decloaking was performed in 10 mM sodium citrate (pH 6.0) and non-specific sites were blocked in TBSTw containing 1% Blocking Reagent (Roche Diagnostics, Indianapolis, IN), 5% normal goat or donkey sera ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100, and 1 mM EDTA) containing a phosphatase inhibitor cocktail (Nacalai Tesque, Kyoto, Japan) and protease inhibitor cocktail (Roche, Basel, Switzerland). After centrifugation at 20,380×g for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were washed once with ice-cold PBS and lysed with ice-cold RIPA buffer containing cOmplete™ Protease Inhibitor Cocktail (Roche Diagnostics). For murine cerebellar samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor tissues were minced into 1×1 mm fragments and enzymatically dissociated in HBSS containing 1 mg/ml collagenase A (#11088793001; Roche, Basel, Switzerland) and 1 μg/ml DNase I (#07900 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Frozen human samples were digested in 600 µl of lysis buffer containing green ceramic beads and the tissue was disrupted using the MagNA Lyser Instrument (Roche Life Science). Total RNA was extracted using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM β-glycerophosphate and 1% Triton) containing protease inhibitor cocktail (Rowe Scientific; CP2778) and PhosSTOP EASYpack Phosphatase Inhibitor Cocktail (Roche; 4906837001) on ice for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... These tissues were cut to ∼2mm pieces and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pIZT-CS2 (1 μg) containing the complete cDNA sequence of BmCPV S2 dsRNA encoding RdRp using Roche-X Gem (Switzerland, Roche, Cat: 6366236001). At 48 h posttransfection ...
-
bioRxiv - Neuroscience 2022Quote: ... The hippocampus tissues were homogenized in lysis buffer (12.5 μL/mg) containing a mixture of protease inhibitors and phenylmethylsulfonyl fluoride (Roche Diagnostics, Indianapolis, IN). The protein concentration was determined by a BCA protein assay kit (Pierce ...
-
bioRxiv - Biochemistry 2024Quote: ... tubes and homogenized for 1.5 minutes in 50μL of TBS containing 1% Triton X-100 (Table 1) and 1X protease and 1X phosphatase inhibitor cocktails (Roche, 04693124001 and 04906837001). The homogenates were then probe-sonicated with a Branson Sonifier® SFX150 (Emerson ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Bronchoalveolar lavage (BAL) was performed by instilling the lungs with phosphate-buffered saline containing a protease inhibitor cocktail (Roche Cat. No. 11836170001) two times ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with a solution containing horseradish peroxidase (HRP)- conjugated anti-Dig (at a dilution of 1:500; #11207733910, Roche Applied Science) and goat anti-mCherry (at a dilution of 1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... Vero/TMPRSS2 cells (JCRB Cell Bank, Cat# JCRB1818) were cultured in DMEM containing 5% FBS and 1 mg/mL G418 (Roche, Basel, Switzerland). VeroE6/TMPRSS2 cells (JCRB Cell Bank ...
-
bioRxiv - Pathology 2023Quote: Human normal and IPF lungs were minced with a razor blade in a 100 mm petri dish in a cold DMEM medium containing 0.2 mg/ml Liberase DL and 100 U/ml DNase I (Roche, Indianapolis, IN, USA). The mixture was transferred into 15 ml tubes and incubated at 37 °C for 35 min in a water bath under continuous rotation to allow enzymatic digestion ...
-
bioRxiv - Pathology 2023Quote: ... The lungs were immediately harvested and minced with a razor blade in a 100 mm petri dish in a cold DMEM medium containing 0.2 mg/ml Liberase DL and 100 U/ml DNase I (Roche, Indianapolis, IN, USA). The mixture was transferred into 15 ml tubes and incubated at 37 °C for 35 min in a water bath under continuous rotation to allow enzymatic digestion ...
-
bioRxiv - Cancer Biology 2023Quote: All experimental cells were subjected to extraction of total proteins in a lysis buffer containing a protease inhibitor cOmplete Tablets EASYpack or phosphatase inhibitor PhosSTOP EASYpack (each tablet per 15 mL buffer, Roche, Basel, Switzerland). The proteins in cell lysates were denatured at 100°C for 10 min ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates for intracellular chemokine quantification were obtained via repeated freeze-thaw cycles at −80°C of cells suspended in media containing protease inhibitor cocktail (Roche Applied Science) and final centrifugation at 8000g to pellet debris ...
-
bioRxiv - Microbiology 2023Quote: ... The pellets were gently resuspended in a mixture of Phosphate Buffered Saline (PBS) containing complete EDTA-free protease inhibitor mixture (Roche Applied Science) followed by cell disruption ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
bioRxiv - Immunology 2023Quote: ... Freshly excised CT26WT tumors were mechanically dissociated through a 70 μm strainer into 6-well culture plates containing DNaseI (10 μg/ml, Roche; Nutley, NJ) and collagenase (10 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were incubated overnight at 60°C in 100 μl of hybe-solution buffer containing 20 ng digoxigenin (Dig)-labeled probes (see below) for colorimetric detection (Roche, cat. #11277073910) or 20 μg of fluorescein-labeled probes (see below ...
-
bioRxiv - Cell Biology 2023Quote: The cell pellets were washed once in PBS and resuspended in 5 ml PBS containing protease inhibitor cocktail (Roche Diagnostics, Penzberg, Germany) and 1 mg/ml lysozyme ...
-
bioRxiv - Microbiology 2022Quote: ... The cell pellet was washed once with 50 mM Tris-HCl (pH 7.0) and resuspended in 1 mL of 50 mM Tris-HCl (pH 7.0) containing protease inhibitors (cOmplete, Roche Applied Science, Mannheim, Germany). The cells were disrupted with glass beads using a FastPrep system (Qbiogene ...
-
bioRxiv - Neuroscience 2023Quote: Samples from the 2D cultures or brain organoids were collected in RIPA buffer containing protease and phosphatase inhibitors (Complete mini, Roche Applied Science) and sonicated several times at 60%-70% for 10 seconds prior to use for the immunoblotting analyses ...
-
bioRxiv - Neuroscience 2023Quote: Lysates from cultured neurons were collected in NP40 lysis buffer (150 mM NaCl, 100 mM Tris-HCl, 1% NP40 in PBS) containing 1X protease inhibitors (cOmplete ULTRA tablets, Roche, cat# 05892970001). Samples were run on mini-protean TGX gels (Biorad ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissue was collected in sodium dodecyl sulfate (SDS)-containing lysis buffer supplemented with protease inhibitors (cOmplete, Cat. No.: 11697498001, Roche, Basel, Switzerland) and homogenized using gentleMACSTM Octo dissociator (Miltenyi ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were lysed in 1% Triton X-100 (20 mM Tris [pH 7], 150 mM NaCl, 5 mM MgCl2) containing protease inhibitor (Roche, Cat# 11697498001) with end-over-end rotation for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Triton X100 with glacial acetic acid added until pH 4.0 was achieved] containing a protease inhibitor cocktail (cOmplete mini tablets, Roche cat. no. 11836153001). Homogenates were prepared via probe sonication for 5-7 sec ...
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... to prepare for an hour long blocking in 10% lamb serum/TBST and an overnight incubation at 4°C in a 1% lamb serum containing Anti-Dig-AP antibody (Roche, 1:5000). The next morning ...
-
bioRxiv - Cell Biology 2020Quote: ... using Kapa SYBR Fast Universal Kit (Roche) with an annealing temperature of 60°C and with primers listed in Supplementary Table S1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using Library Quantification Kit (KK4854, Kapa Biosystems), and multiplexed by pooling equimolar amounts of each library prior to sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... using SYBR Fast Universal kit (Kapa Biosystems). The average threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2020Quote: ... or Kapa Library Quantification kit (Kapa Biosystems). One hundred cycle paired end sequencing was performed on an Illumina HiSeq 4000 (single copy strains ...
-
bioRxiv - Pathology 2020Quote: ... DAB Map detection kit (Roche Diagnostics KK) was used for visualization ...
-
bioRxiv - Genomics 2020Quote: ... using a nick translation kit (Roche Diagnostics).
-
bioRxiv - Cell Biology 2021Quote: ... using KAPA Hyperprep mRNA Library Kit (Roche) and Illumina adapters (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Kapa Library Quantification Kit (Kapa Biosystems). Finally ...
-
bioRxiv - Plant Biology 2021Quote: ... using KAPA SYBR FAST qPCR Kits (Roche) and the gene-specific primer sets shown in Supplementary Table ## ...
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... and the KAPA Library Quantification Kit (Roche). Pooled libraries were then sequenced using the NextSeq 500 System at the Stanford Functional Genomics Facility (Stanford ...
-
bioRxiv - Genomics 2021Quote: ... Transcriptor High Fidelity cDNA Synthesis Kit (Roche) was used for cDNA synthesis with OligodT primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... KAPA SYBR Fast qPCR Kit (Roche, USA), Tn5-1789F and Tn5-1879R primer sets were used for quantification ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cytotoxicity detection kits were purchased from Roche Diagnostics Ltd (West Sussex ...
-
bioRxiv - Immunology 2022Quote: Cytotoxicity Detection LDH Kit (Roche, Indianapolis, USA) was used on cell supernatants according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and KAPA Library Quantification Kits (KAPA Biosystems). The size of sequencing libraries was determined by means of High Sensitivity D5000 Assay in at Tapestation 4200 system (Agilent) ...
-
bioRxiv - Genetics 2022Quote: ... KAPA Library Quantification kit (Roche, Cat# KK4824) and TapeStation 2200 (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... A KAPA Hyper Prep Kit (Kapa Biosystems) was used to prepare Illumina libraries following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Kapa Stranded mRNA-Seq kit (Roche) was used ...